Incidental Mutation 'R2350:Mocos'
ID246085
Institutional Source Beutler Lab
Gene Symbol Mocos
Ensembl Gene ENSMUSG00000039616
Gene Namemolybdenum cofactor sulfurase
Synonyms1110018O12Rik
MMRRC Submission 040332-MU
Accession Numbers

NCBI RefSeq: NM_026779.1; MGI:1915841

Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R2350 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location24653691-24701556 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 24666656 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000063609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068006]
Predicted Effect probably benign
Transcript: ENSMUST00000068006
SMART Domains Protein: ENSMUSP00000063609
Gene: ENSMUSG00000039616

DomainStartEndE-ValueType
Pfam:Aminotran_5 50 481 7.5e-29 PFAM
Pfam:MOSC_N 569 689 1.1e-32 PFAM
Pfam:MOSC 715 853 3.7e-21 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MOCOS sulfurates the molybdenum cofactor of xanthine dehydrogenase (XDH; MIM 607633) and aldehyde oxidase (AOX1; MIM 602841), which is required for their enzymatic activities (Ichida et al., 2001 [PubMed 11302742]).[supplied by OMIM, Feb 2010]
Allele List at MGI

All alleles(11) : Targeted(1) Gene trapped(10)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,678,088 probably benign Het
Adam12 T C 7: 133,919,524 T312A probably damaging Het
Adamts20 C T 15: 94,283,916 C1632Y probably damaging Het
Ago2 T C 15: 73,119,461 M543V probably benign Het
Alpk3 T C 7: 81,094,970 L1271P probably damaging Het
Arpin T A 7: 79,931,805 K56* probably null Het
Ccdc138 G T 10: 58,561,893 probably benign Het
Ccdc63 A T 5: 122,122,885 M192K probably benign Het
Cldn12 A T 5: 5,507,845 V194D possibly damaging Het
Cntnap5b T C 1: 100,379,126 L485P probably damaging Het
Cpne7 A G 8: 123,124,469 D165G probably damaging Het
Cyp2j6 A T 4: 96,529,408 M326K probably damaging Het
D630003M21Rik T A 2: 158,201,011 T870S probably damaging Het
Dennd2c A G 3: 103,132,001 D155G probably benign Het
Dnah3 A T 7: 120,045,788 probably null Het
Dqx1 T A 6: 83,059,087 C133* probably null Het
Fam234b T A 6: 135,231,724 V545E probably damaging Het
Flcn T C 11: 59,792,659 H564R probably damaging Het
Gsdmc4 T A 15: 63,893,165 H348L probably benign Het
Gucy2c G T 6: 136,763,074 P252T probably damaging Het
Insl6 T A 19: 29,325,245 E24V possibly damaging Het
Irx1 T A 13: 71,960,048 T172S probably damaging Het
Myom2 T C 8: 15,108,835 V837A probably benign Het
Nfatc2ip T C 7: 126,395,998 N126S probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Npepl1 T C 2: 174,111,773 S166P probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr867 G T 9: 20,055,088 A125D probably damaging Het
Otop2 T G 11: 115,326,850 C171G probably damaging Het
Parpbp C A 10: 88,133,088 probably benign Het
Pcdhb20 T A 18: 37,504,510 S30T probably benign Het
Phkg1 A T 5: 129,864,532 V359E probably damaging Het
Ppp2cb A G 8: 33,611,827 D131G probably null Het
Scn9a A G 2: 66,504,968 Y1226H probably damaging Het
Unc5b A G 10: 60,778,200 F290S probably benign Het
Vmn1r71 A G 7: 10,747,919 F215L probably benign Het
Vmn2r101 T C 17: 19,589,783 V277A probably benign Het
Vmn2r6 T C 3: 64,556,352 S354G probably benign Het
Zfp292 A T 4: 34,811,281 S588T probably damaging Het
Other mutations in Mocos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Mocos APN 18 24660044 missense possibly damaging 0.88
IGL01859:Mocos APN 18 24666660 splice site probably benign
IGL01884:Mocos APN 18 24683216 missense probably damaging 1.00
IGL02174:Mocos APN 18 24695896 missense probably benign 0.00
IGL02966:Mocos APN 18 24676611 missense probably damaging 1.00
IGL02976:Mocos APN 18 24666569 missense possibly damaging 0.92
P0008:Mocos UTSW 18 24679606 missense probably benign 0.32
PIT4810001:Mocos UTSW 18 24686702 missense probably damaging 1.00
R0131:Mocos UTSW 18 24679762 missense probably benign 0.01
R0131:Mocos UTSW 18 24679762 missense probably benign 0.01
R0132:Mocos UTSW 18 24679762 missense probably benign 0.01
R0265:Mocos UTSW 18 24666276 missense probably benign 0.01
R0737:Mocos UTSW 18 24688987 missense probably damaging 0.98
R1231:Mocos UTSW 18 24679701 missense probably benign 0.01
R1351:Mocos UTSW 18 24660050 missense probably damaging 1.00
R1699:Mocos UTSW 18 24683216 missense probably damaging 1.00
R1853:Mocos UTSW 18 24695969 missense probably damaging 1.00
R2190:Mocos UTSW 18 24664057 missense probably benign 0.01
R2680:Mocos UTSW 18 24676629 missense probably damaging 1.00
R3840:Mocos UTSW 18 24676624 missense probably damaging 1.00
R3841:Mocos UTSW 18 24676624 missense probably damaging 1.00
R3847:Mocos UTSW 18 24676662 missense probably damaging 0.99
R4059:Mocos UTSW 18 24679390 missense probably damaging 1.00
R4158:Mocos UTSW 18 24674246 missense probably damaging 0.99
R4205:Mocos UTSW 18 24666191 missense possibly damaging 0.88
R4514:Mocos UTSW 18 24683212 missense probably damaging 0.99
R4589:Mocos UTSW 18 24654038 missense probably damaging 0.99
R4667:Mocos UTSW 18 24666434 missense probably benign 0.11
R4668:Mocos UTSW 18 24666434 missense probably benign 0.11
R5162:Mocos UTSW 18 24654052 missense probably damaging 0.98
R5187:Mocos UTSW 18 24692554 missense probably damaging 0.97
R5533:Mocos UTSW 18 24674300 missense probably damaging 1.00
R5629:Mocos UTSW 18 24664085 critical splice donor site probably null
R5661:Mocos UTSW 18 24665995 splice site probably null
R5952:Mocos UTSW 18 24701387 missense possibly damaging 0.91
R5987:Mocos UTSW 18 24686693 missense probably damaging 1.00
R6173:Mocos UTSW 18 24676582 missense probably benign 0.03
R6209:Mocos UTSW 18 24666615 missense probably benign 0.41
R6376:Mocos UTSW 18 24701485 missense possibly damaging 0.50
R6416:Mocos UTSW 18 24701456 missense probably damaging 0.99
R6452:Mocos UTSW 18 24695941 missense probably benign 0.02
R6520:Mocos UTSW 18 24666390 missense probably benign 0.01
R6631:Mocos UTSW 18 24699931 missense probably benign 0.03
R6669:Mocos UTSW 18 24666410 missense probably damaging 0.98
R7114:Mocos UTSW 18 24666515 missense probably damaging 1.00
R7366:Mocos UTSW 18 24676616 missense probably damaging 1.00
R7690:Mocos UTSW 18 24664025 missense probably damaging 1.00
Z1176:Mocos UTSW 18 24670633 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCAGCCTCCTATGTCAGC -3'
(R):5'- GGCACATTCCTGCTGATCTTTG -3'

Sequencing Primer
(F):5'- TTGGATCTGTCAGCTCACCAGG -3'
(R):5'- GATCTTTGCCTCCCAGATCTGAG -3'
Posted On2014-10-30