Incidental Mutation 'R2351:Dap3'
ID246111
Institutional Source Beutler Lab
Gene Symbol Dap3
Ensembl Gene ENSMUSG00000068921
Gene Namedeath associated protein 3
SynonymsDAP-3, 4921514D13Rik
MMRRC Submission 040333-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2351 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88920803-88951181 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 88933563 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090938] [ENSMUST00000107491] [ENSMUST00000172942] [ENSMUST00000173021] [ENSMUST00000173135] [ENSMUST00000174077] [ENSMUST00000174402] [ENSMUST00000174491]
Predicted Effect probably null
Transcript: ENSMUST00000090938
SMART Domains Protein: ENSMUSP00000088456
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 97 392 2.1e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107491
SMART Domains Protein: ENSMUSP00000103115
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 97 306 1e-67 PFAM
Pfam:DAP3 300 362 6.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172942
SMART Domains Protein: ENSMUSP00000134145
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 63 133 4.3e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173021
SMART Domains Protein: ENSMUSP00000133314
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 92 200 2.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173094
SMART Domains Protein: ENSMUSP00000133486
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 9 140 6.5e-48 PFAM
Pfam:DAP3 134 251 4.3e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173135
SMART Domains Protein: ENSMUSP00000134422
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 92 387 8e-90 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174077
SMART Domains Protein: ENSMUSP00000134433
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 92 212 7.1e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174402
SMART Domains Protein: ENSMUSP00000133395
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 79 165 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174491
Predicted Effect probably benign
Transcript: ENSMUST00000174571
SMART Domains Protein: ENSMUSP00000133349
Gene: ENSMUSG00000068921

DomainStartEndE-ValueType
Pfam:DAP3 1 102 4.7e-36 PFAM
Pfam:DAP3 99 213 7e-24 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that also participates in apoptotic pathways which are initiated by tumor necrosis factor-alpha, Fas ligand, and gamma interferon. This protein potentially binds ATP/GTP and might be a functional partner of the mitoribosomal protein S27. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 1q and 2q. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality with defects in mitochondria morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A T 1: 138,852,108 Y135* probably null Het
2700081O15Rik T C 19: 7,422,244 I247T probably damaging Het
9430007A20Rik A T 4: 144,528,778 Y256F probably damaging Het
Acad10 A T 5: 121,629,927 I820K probably benign Het
Arl8b A T 6: 108,821,523 I178F possibly damaging Het
Asap1 A T 15: 64,135,804 probably null Het
Atp2b2 A T 6: 113,789,757 I552N possibly damaging Het
C130074G19Rik G T 1: 184,882,863 D43E probably benign Het
Ccdc162 C A 10: 41,555,972 probably null Het
Ccdc186 T G 19: 56,798,697 K613T possibly damaging Het
Cggbp1 T A 16: 64,855,683 D37E possibly damaging Het
Cntn3 A T 6: 102,337,383 N123K possibly damaging Het
Col18a1 C T 10: 77,112,704 G325S probably benign Het
Cwc25 G T 11: 97,747,392 T405K probably damaging Het
Cyp4a31 T C 4: 115,571,313 V370A possibly damaging Het
Cyp4f13 T G 17: 32,925,596 I309L probably benign Het
Dchs1 G T 7: 105,754,094 D3080E probably benign Het
Ern2 A G 7: 122,171,508 V762A probably damaging Het
Fgr C T 4: 132,997,237 R255C probably damaging Het
Gcm2 A T 13: 41,103,618 D218E probably benign Het
Gfi1 A G 5: 107,721,774 S131P probably damaging Het
Grm8 A T 6: 28,126,119 C3S possibly damaging Het
Gucy2d A G 7: 98,464,019 D840G probably benign Het
H3f3a T C 1: 180,810,158 T81A probably benign Het
Igsf23 C T 7: 19,944,798 W22* probably null Het
Il12rb2 G A 6: 67,361,944 Q3* probably null Het
Ino80d A T 1: 63,085,835 L156H probably benign Het
Kdm2a G A 19: 4,329,126 P554S probably benign Het
Lefty1 T A 1: 180,937,242 L244H possibly damaging Het
Mdn1 T A 4: 32,750,010 S4398T probably benign Het
Myh10 A G 11: 68,793,139 D1126G probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myom1 A T 17: 71,034,579 D111V probably damaging Het
Naip6 T A 13: 100,283,661 D1367V probably damaging Het
Nbeal1 A T 1: 60,237,098 H666L possibly damaging Het
Nsmaf T A 4: 6,437,921 I77F probably damaging Het
Nvl T C 1: 181,130,792 T231A probably benign Het
Obscn T C 11: 59,112,612 R1287G probably damaging Het
Olfr1058 C T 2: 86,386,127 C97Y probably damaging Het
Olfr1219 C T 2: 89,074,399 G231S possibly damaging Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr2 A T 7: 107,001,676 Y61* probably null Het
Olfr420 T A 1: 174,158,920 V49D probably damaging Het
Olfr765 A G 10: 129,046,928 V45A probably benign Het
Opn3 T C 1: 175,692,511 D9G probably benign Het
Parp10 A T 15: 76,242,856 S101R probably benign Het
Pdhx T A 2: 103,024,217 K399* probably null Het
Pdia4 A T 6: 47,796,914 probably null Het
Pla2g4f T C 2: 120,300,442 D844G probably benign Het
Prtg C A 9: 72,856,824 D526E probably damaging Het
Rassf6 T C 5: 90,631,559 D5G probably benign Het
Riok3 C T 18: 12,149,667 Q388* probably null Het
Robo4 T A 9: 37,411,660 F825L probably benign Het
Rpl13a-ps1 C T 19: 50,030,429 E103K probably benign Het
Rpl18a A T 8: 70,896,220 H37Q probably benign Het
Ryr1 A T 7: 29,075,293 S2301T probably benign Het
Slc39a9 T A 12: 80,644,886 D2E possibly damaging Het
Slco5a1 C T 1: 12,989,934 V188I probably benign Het
Son T A 16: 91,657,659 M1098K probably damaging Het
Spag9 A G 11: 94,092,900 D701G probably damaging Het
Ssmem1 T C 6: 30,512,496 F46S possibly damaging Het
Sspo C T 6: 48,464,869 R1938W probably damaging Het
Sstr3 T C 15: 78,539,921 I209V probably benign Het
Tlk2 A G 11: 105,209,830 Y87C probably damaging Het
Traf4 G A 11: 78,160,176 R385W probably damaging Het
Triobp G A 15: 79,004,580 V1962M probably benign Het
Tspan12 T G 6: 21,835,507 I56L probably benign Het
Upp2 T A 2: 58,763,662 probably null Het
Vps13b T C 15: 35,869,311 W2654R probably damaging Het
Zc3h18 C T 8: 122,403,187 R435* probably null Het
Other mutations in Dap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Dap3 APN 3 88936228 missense probably benign 0.23
IGL02111:Dap3 APN 3 88929418 missense probably benign 0.26
IGL02453:Dap3 APN 3 88928327 missense probably benign 0.07
IGL02989:Dap3 APN 3 88930571 splice site probably benign
R0094:Dap3 UTSW 3 88927028 missense probably benign 0.01
R0665:Dap3 UTSW 3 88930997 nonsense probably null
R1853:Dap3 UTSW 3 88930926 missense probably damaging 1.00
R1885:Dap3 UTSW 3 88930974 missense probably damaging 1.00
R1887:Dap3 UTSW 3 88930974 missense probably damaging 1.00
R2513:Dap3 UTSW 3 88928258 missense probably benign 0.15
R4449:Dap3 UTSW 3 88949878 unclassified probably benign
R4749:Dap3 UTSW 3 88926310 missense probably benign 0.00
R5359:Dap3 UTSW 3 88930989 missense probably damaging 1.00
R5502:Dap3 UTSW 3 88925326 missense probably damaging 1.00
R6899:Dap3 UTSW 3 88933600 missense probably benign 0.01
R6919:Dap3 UTSW 3 88930989 missense probably damaging 0.98
R6946:Dap3 UTSW 3 88938216 start gained probably benign
R8188:Dap3 UTSW 3 88936236 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGAAGTGTACTTAAGTGGCTAAC -3'
(R):5'- AACTGTTTGCCCAAGCTGTG -3'

Sequencing Primer
(F):5'- CAAAAGATAAATCCTAAACGTGGTGC -3'
(R):5'- TGCAAGGACTTTATAGCCTAGGC -3'
Posted On2014-10-30