Incidental Mutation 'R2351:Gfi1'
ID246119
Institutional Source Beutler Lab
Gene Symbol Gfi1
Ensembl Gene ENSMUSG00000029275
Gene Namegrowth factor independent 1
SynonymsPal-1, Gfi-1, Pal1
MMRRC Submission 040333-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2351 (G1)
Quality Score145
Status Not validated
Chromosome5
Chromosomal Location107716657-107726036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107721774 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 131 (S131P)
Ref Sequence ENSEMBL: ENSMUSP00000135880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031205] [ENSMUST00000065478] [ENSMUST00000159164] [ENSMUST00000159263]
Predicted Effect probably damaging
Transcript: ENSMUST00000031205
AA Change: S131P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135884
Gene: ENSMUSG00000029275
AA Change: S131P

DomainStartEndE-ValueType
low complexity region 174 181 N/A INTRINSIC
low complexity region 184 202 N/A INTRINSIC
ZnF_C2H2 256 279 8.47e-4 SMART
ZnF_C2H2 285 307 1.82e-3 SMART
ZnF_C2H2 313 335 3.16e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2HC 342 358 5.37e0 SMART
ZnF_C2H2 369 391 1.47e-3 SMART
ZnF_C2H2 397 420 1.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065478
AA Change: S197P

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135039
Gene: ENSMUSG00000029275
AA Change: S197P

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 240 247 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
ZnF_C2H2 322 345 8.47e-4 SMART
ZnF_C2H2 351 373 1.82e-3 SMART
ZnF_C2H2 379 401 3.16e-3 SMART
ZnF_C2H2 407 429 3.89e-3 SMART
ZnF_C2HC 408 424 5.37e0 SMART
ZnF_C2H2 435 457 1.47e-3 SMART
ZnF_C2H2 463 486 1.36e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159164
AA Change: S131P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137229
Gene: ENSMUSG00000029275
AA Change: S131P

DomainStartEndE-ValueType
low complexity region 174 181 N/A INTRINSIC
low complexity region 184 202 N/A INTRINSIC
ZnF_C2H2 256 279 8.47e-4 SMART
ZnF_C2H2 285 307 1.82e-3 SMART
ZnF_C2H2 313 335 3.16e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2HC 342 358 5.37e0 SMART
ZnF_C2H2 369 391 1.47e-3 SMART
ZnF_C2H2 397 420 1.36e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159263
AA Change: S131P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135880
Gene: ENSMUSG00000029275
AA Change: S131P

DomainStartEndE-ValueType
low complexity region 174 181 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162148
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear zinc finger protein that functions as a transcriptional repressor. This protein plays a role in diverse developmental contexts, including hematopoiesis and oncogenesis. It functions as part of a complex along with other cofactors to control histone modifications that lead to silencing of the target gene promoters. Mutations in this gene cause autosomal dominant severe congenital neutropenia, and also dominant nonimmune chronic idiopathic neutropenia of adults, which are heterogeneous hematopoietic disorders that cause predispositions to leukemias and infections. Multiple alternatively spliced variants, encoding the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit loss of inner ear hair cells, ataxia, circling, and deafness. Mutants also show a block in granulocyte and neutrophil maturation, and are hypersensitive to endotoxin stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A T 1: 138,852,108 Y135* probably null Het
2700081O15Rik T C 19: 7,422,244 I247T probably damaging Het
9430007A20Rik A T 4: 144,528,778 Y256F probably damaging Het
Acad10 A T 5: 121,629,927 I820K probably benign Het
Arl8b A T 6: 108,821,523 I178F possibly damaging Het
Asap1 A T 15: 64,135,804 probably null Het
Atp2b2 A T 6: 113,789,757 I552N possibly damaging Het
C130074G19Rik G T 1: 184,882,863 D43E probably benign Het
Ccdc162 C A 10: 41,555,972 probably null Het
Ccdc186 T G 19: 56,798,697 K613T possibly damaging Het
Cggbp1 T A 16: 64,855,683 D37E possibly damaging Het
Cntn3 A T 6: 102,337,383 N123K possibly damaging Het
Col18a1 C T 10: 77,112,704 G325S probably benign Het
Cwc25 G T 11: 97,747,392 T405K probably damaging Het
Cyp4a31 T C 4: 115,571,313 V370A possibly damaging Het
Cyp4f13 T G 17: 32,925,596 I309L probably benign Het
Dap3 A T 3: 88,933,563 probably null Het
Dchs1 G T 7: 105,754,094 D3080E probably benign Het
Ern2 A G 7: 122,171,508 V762A probably damaging Het
Fgr C T 4: 132,997,237 R255C probably damaging Het
Gcm2 A T 13: 41,103,618 D218E probably benign Het
Grm8 A T 6: 28,126,119 C3S possibly damaging Het
Gucy2d A G 7: 98,464,019 D840G probably benign Het
H3f3a T C 1: 180,810,158 T81A probably benign Het
Igsf23 C T 7: 19,944,798 W22* probably null Het
Il12rb2 G A 6: 67,361,944 Q3* probably null Het
Ino80d A T 1: 63,085,835 L156H probably benign Het
Kdm2a G A 19: 4,329,126 P554S probably benign Het
Lefty1 T A 1: 180,937,242 L244H possibly damaging Het
Mdn1 T A 4: 32,750,010 S4398T probably benign Het
Myh10 A G 11: 68,793,139 D1126G probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myom1 A T 17: 71,034,579 D111V probably damaging Het
Naip6 T A 13: 100,283,661 D1367V probably damaging Het
Nbeal1 A T 1: 60,237,098 H666L possibly damaging Het
Nsmaf T A 4: 6,437,921 I77F probably damaging Het
Nvl T C 1: 181,130,792 T231A probably benign Het
Obscn T C 11: 59,112,612 R1287G probably damaging Het
Olfr1058 C T 2: 86,386,127 C97Y probably damaging Het
Olfr1219 C T 2: 89,074,399 G231S possibly damaging Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr2 A T 7: 107,001,676 Y61* probably null Het
Olfr420 T A 1: 174,158,920 V49D probably damaging Het
Olfr765 A G 10: 129,046,928 V45A probably benign Het
Opn3 T C 1: 175,692,511 D9G probably benign Het
Parp10 A T 15: 76,242,856 S101R probably benign Het
Pdhx T A 2: 103,024,217 K399* probably null Het
Pdia4 A T 6: 47,796,914 probably null Het
Pla2g4f T C 2: 120,300,442 D844G probably benign Het
Prtg C A 9: 72,856,824 D526E probably damaging Het
Rassf6 T C 5: 90,631,559 D5G probably benign Het
Riok3 C T 18: 12,149,667 Q388* probably null Het
Robo4 T A 9: 37,411,660 F825L probably benign Het
Rpl13a-ps1 C T 19: 50,030,429 E103K probably benign Het
Rpl18a A T 8: 70,896,220 H37Q probably benign Het
Ryr1 A T 7: 29,075,293 S2301T probably benign Het
Slc39a9 T A 12: 80,644,886 D2E possibly damaging Het
Slco5a1 C T 1: 12,989,934 V188I probably benign Het
Son T A 16: 91,657,659 M1098K probably damaging Het
Spag9 A G 11: 94,092,900 D701G probably damaging Het
Ssmem1 T C 6: 30,512,496 F46S possibly damaging Het
Sspo C T 6: 48,464,869 R1938W probably damaging Het
Sstr3 T C 15: 78,539,921 I209V probably benign Het
Tlk2 A G 11: 105,209,830 Y87C probably damaging Het
Traf4 G A 11: 78,160,176 R385W probably damaging Het
Triobp G A 15: 79,004,580 V1962M probably benign Het
Tspan12 T G 6: 21,835,507 I56L probably benign Het
Upp2 T A 2: 58,763,662 probably null Het
Vps13b T C 15: 35,869,311 W2654R probably damaging Het
Zc3h18 C T 8: 122,403,187 R435* probably null Het
Other mutations in Gfi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Gfi1 APN 5 107723722 unclassified probably null
Pileup UTSW 5 107717768 missense probably damaging 1.00
Super8 UTSW 5 107720143 missense probably damaging 0.99
R1314:Gfi1 UTSW 5 107721874 splice site probably null
R2680:Gfi1 UTSW 5 107721431 missense probably damaging 1.00
R4687:Gfi1 UTSW 5 107723810 missense probably damaging 1.00
R4885:Gfi1 UTSW 5 107723286 missense probably damaging 1.00
R4951:Gfi1 UTSW 5 107720143 missense probably damaging 0.99
R5540:Gfi1 UTSW 5 107720125 missense probably damaging 0.99
R6193:Gfi1 UTSW 5 107721531 missense probably benign 0.45
R6782:Gfi1 UTSW 5 107725953 critical splice donor site probably null
R6993:Gfi1 UTSW 5 107717768 missense probably damaging 1.00
R7378:Gfi1 UTSW 5 107723229 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- CCATGATCTTGGTACAGCCG -3'
(R):5'- GCGCCTGACAATAGTGATGGTG -3'

Sequencing Primer
(F):5'- AAGTCGCCGTAGAGCCC -3'
(R):5'- AGTGATGGTGCACTGCG -3'
Posted On2014-10-30