Incidental Mutation 'R2351:Ssmem1'
ID246125
Institutional Source Beutler Lab
Gene Symbol Ssmem1
Ensembl Gene ENSMUSG00000029784
Gene Nameserine-rich single-pass membrane protein 1
Synonyms1700025E21Rik, 1700016K02Rik
MMRRC Submission 040333-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2351 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location30509849-30520254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 30512496 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 46 (F46S)
Ref Sequence ENSEMBL: ENSMUSP00000031798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031797] [ENSMUST00000031798] [ENSMUST00000064330] [ENSMUST00000102991] [ENSMUST00000115157] [ENSMUST00000115160] [ENSMUST00000131485] [ENSMUST00000138823] [ENSMUST00000148638] [ENSMUST00000151187] [ENSMUST00000154547]
Predicted Effect probably benign
Transcript: ENSMUST00000031797
SMART Domains Protein: ENSMUSP00000031797
Gene: ENSMUSG00000029784

DomainStartEndE-ValueType
Pfam:DUF4636 1 195 3.5e-100 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000031798
AA Change: F46S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031798
Gene: ENSMUSG00000029784
AA Change: F46S

DomainStartEndE-ValueType
Pfam:DUF4636 1 243 1e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064330
SMART Domains Protein: ENSMUSP00000067667
Gene: ENSMUSG00000029782

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 343 4.1e-88 PFAM
Pfam:CytochromB561_N 341 438 2.2e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102991
SMART Domains Protein: ENSMUSP00000100056
Gene: ENSMUSG00000029782

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 376 5.2e-107 PFAM
Pfam:CytochromB561_N 372 519 3.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115157
SMART Domains Protein: ENSMUSP00000110810
Gene: ENSMUSG00000029782

DomainStartEndE-ValueType
Pfam:CytochromB561_N 4 560 4.8e-209 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115160
SMART Domains Protein: ENSMUSP00000110813
Gene: ENSMUSG00000029782

DomainStartEndE-ValueType
Pfam:CytochromB561_N 6 560 6.4e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131485
SMART Domains Protein: ENSMUSP00000122018
Gene: ENSMUSG00000029784

DomainStartEndE-ValueType
Pfam:DUF4636 1 67 4.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138823
SMART Domains Protein: ENSMUSP00000138292
Gene: ENSMUSG00000029782

DomainStartEndE-ValueType
Pfam:CytochromB561_N 5 560 1.2e-205 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148638
SMART Domains Protein: ENSMUSP00000115567
Gene: ENSMUSG00000029782

DomainStartEndE-ValueType
Pfam:CytochromB561_N 4 71 1.3e-15 PFAM
Pfam:CytochromB561_N 67 139 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150480
Predicted Effect probably benign
Transcript: ENSMUST00000151187
SMART Domains Protein: ENSMUSP00000138232
Gene: ENSMUSG00000029782

DomainStartEndE-ValueType
Pfam:CytochromB561_N 1 403 1.5e-160 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154547
SMART Domains Protein: ENSMUSP00000145248
Gene: ENSMUSG00000029782

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A T 1: 138,852,108 Y135* probably null Het
2700081O15Rik T C 19: 7,422,244 I247T probably damaging Het
9430007A20Rik A T 4: 144,528,778 Y256F probably damaging Het
Acad10 A T 5: 121,629,927 I820K probably benign Het
Arl8b A T 6: 108,821,523 I178F possibly damaging Het
Asap1 A T 15: 64,135,804 probably null Het
Atp2b2 A T 6: 113,789,757 I552N possibly damaging Het
C130074G19Rik G T 1: 184,882,863 D43E probably benign Het
Ccdc162 C A 10: 41,555,972 probably null Het
Ccdc186 T G 19: 56,798,697 K613T possibly damaging Het
Cggbp1 T A 16: 64,855,683 D37E possibly damaging Het
Cntn3 A T 6: 102,337,383 N123K possibly damaging Het
Col18a1 C T 10: 77,112,704 G325S probably benign Het
Cwc25 G T 11: 97,747,392 T405K probably damaging Het
Cyp4a31 T C 4: 115,571,313 V370A possibly damaging Het
Cyp4f13 T G 17: 32,925,596 I309L probably benign Het
Dap3 A T 3: 88,933,563 probably null Het
Dchs1 G T 7: 105,754,094 D3080E probably benign Het
Ern2 A G 7: 122,171,508 V762A probably damaging Het
Fgr C T 4: 132,997,237 R255C probably damaging Het
Gcm2 A T 13: 41,103,618 D218E probably benign Het
Gfi1 A G 5: 107,721,774 S131P probably damaging Het
Grm8 A T 6: 28,126,119 C3S possibly damaging Het
Gucy2d A G 7: 98,464,019 D840G probably benign Het
H3f3a T C 1: 180,810,158 T81A probably benign Het
Igsf23 C T 7: 19,944,798 W22* probably null Het
Il12rb2 G A 6: 67,361,944 Q3* probably null Het
Ino80d A T 1: 63,085,835 L156H probably benign Het
Kdm2a G A 19: 4,329,126 P554S probably benign Het
Lefty1 T A 1: 180,937,242 L244H possibly damaging Het
Mdn1 T A 4: 32,750,010 S4398T probably benign Het
Myh10 A G 11: 68,793,139 D1126G probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myom1 A T 17: 71,034,579 D111V probably damaging Het
Naip6 T A 13: 100,283,661 D1367V probably damaging Het
Nbeal1 A T 1: 60,237,098 H666L possibly damaging Het
Nsmaf T A 4: 6,437,921 I77F probably damaging Het
Nvl T C 1: 181,130,792 T231A probably benign Het
Obscn T C 11: 59,112,612 R1287G probably damaging Het
Olfr1058 C T 2: 86,386,127 C97Y probably damaging Het
Olfr1219 C T 2: 89,074,399 G231S possibly damaging Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr2 A T 7: 107,001,676 Y61* probably null Het
Olfr420 T A 1: 174,158,920 V49D probably damaging Het
Olfr765 A G 10: 129,046,928 V45A probably benign Het
Opn3 T C 1: 175,692,511 D9G probably benign Het
Parp10 A T 15: 76,242,856 S101R probably benign Het
Pdhx T A 2: 103,024,217 K399* probably null Het
Pdia4 A T 6: 47,796,914 probably null Het
Pla2g4f T C 2: 120,300,442 D844G probably benign Het
Prtg C A 9: 72,856,824 D526E probably damaging Het
Rassf6 T C 5: 90,631,559 D5G probably benign Het
Riok3 C T 18: 12,149,667 Q388* probably null Het
Robo4 T A 9: 37,411,660 F825L probably benign Het
Rpl13a-ps1 C T 19: 50,030,429 E103K probably benign Het
Rpl18a A T 8: 70,896,220 H37Q probably benign Het
Ryr1 A T 7: 29,075,293 S2301T probably benign Het
Slc39a9 T A 12: 80,644,886 D2E possibly damaging Het
Slco5a1 C T 1: 12,989,934 V188I probably benign Het
Son T A 16: 91,657,659 M1098K probably damaging Het
Spag9 A G 11: 94,092,900 D701G probably damaging Het
Sspo C T 6: 48,464,869 R1938W probably damaging Het
Sstr3 T C 15: 78,539,921 I209V probably benign Het
Tlk2 A G 11: 105,209,830 Y87C probably damaging Het
Traf4 G A 11: 78,160,176 R385W probably damaging Het
Triobp G A 15: 79,004,580 V1962M probably benign Het
Tspan12 T G 6: 21,835,507 I56L probably benign Het
Upp2 T A 2: 58,763,662 probably null Het
Vps13b T C 15: 35,869,311 W2654R probably damaging Het
Zc3h18 C T 8: 122,403,187 R435* probably null Het
Other mutations in Ssmem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02391:Ssmem1 APN 6 30512442 missense possibly damaging 0.85
R0070:Ssmem1 UTSW 6 30519421 missense possibly damaging 0.92
R0110:Ssmem1 UTSW 6 30519548 unclassified probably null
R0469:Ssmem1 UTSW 6 30519548 unclassified probably null
R0510:Ssmem1 UTSW 6 30519548 unclassified probably null
R1544:Ssmem1 UTSW 6 30519651 missense probably damaging 1.00
R1629:Ssmem1 UTSW 6 30512492 missense possibly damaging 0.93
R1656:Ssmem1 UTSW 6 30517508 missense probably damaging 1.00
R4713:Ssmem1 UTSW 6 30519514 missense probably damaging 0.99
R6301:Ssmem1 UTSW 6 30519759 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCCAGGGAAGTTGTCCTAGG -3'
(R):5'- ACATGCCTAAGGACTATCTCAC -3'

Sequencing Primer
(F):5'- CAGGGAAGTTGTCCTAGGTCACG -3'
(R):5'- AGACCGAAAAGGATTCCC -3'
Posted On2014-10-30