Incidental Mutation 'R2351:Col18a1'
List |< first << previous [record 13 of 71] next >> last >|
ID246145
Institutional Source Beutler Lab
Gene Symbol Col18a1
Ensembl Gene ENSMUSG00000001435
Gene Namecollagen, type XVIII, alpha 1
Synonymsendostatin
MMRRC Submission 040333-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2351 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location77052178-77166548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 77112704 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 325 (G325S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072755] [ENSMUST00000081654] [ENSMUST00000105409]
Predicted Effect unknown
Transcript: ENSMUST00000072755
AA Change: G325S
SMART Domains Protein: ENSMUSP00000072538
Gene: ENSMUSG00000001435
AA Change: G325S

DomainStartEndE-ValueType
Pfam:DUF959 16 218 6.8e-104 PFAM
low complexity region 295 307 N/A INTRINSIC
FRI 369 484 4.03e-47 SMART
TSPN 492 680 4.25e-72 SMART
LamG 541 679 2.17e-2 SMART
low complexity region 699 715 N/A INTRINSIC
low complexity region 719 734 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
Pfam:Collagen 820 881 5.5e-11 PFAM
low complexity region 921 942 N/A INTRINSIC
Pfam:Collagen 951 1008 6.1e-10 PFAM
Pfam:Collagen 988 1053 1.4e-8 PFAM
Pfam:Collagen 1060 1117 7.3e-10 PFAM
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1166 1181 N/A INTRINSIC
low complexity region 1186 1202 N/A INTRINSIC
Pfam:Collagen 1207 1267 8.2e-10 PFAM
low complexity region 1275 1288 N/A INTRINSIC
low complexity region 1301 1319 N/A INTRINSIC
low complexity region 1358 1393 N/A INTRINSIC
low complexity region 1397 1414 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1441 1454 N/A INTRINSIC
Pfam:Endostatin 1461 1769 4.4e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081654
SMART Domains Protein: ENSMUSP00000080358
Gene: ENSMUSG00000001435

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
TSPN 33 221 4.25e-72 SMART
LamG 82 220 2.17e-2 SMART
low complexity region 240 256 N/A INTRINSIC
low complexity region 260 275 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Pfam:Collagen 359 422 1.6e-10 PFAM
low complexity region 462 483 N/A INTRINSIC
Pfam:Collagen 492 549 1.6e-9 PFAM
Pfam:Collagen 529 594 3.3e-8 PFAM
Pfam:Collagen 601 658 1.9e-9 PFAM
Pfam:Collagen 631 689 4e-8 PFAM
Pfam:Collagen 701 752 1.7e-7 PFAM
Pfam:Collagen 748 808 2.2e-9 PFAM
low complexity region 816 829 N/A INTRINSIC
low complexity region 842 860 N/A INTRINSIC
low complexity region 899 934 N/A INTRINSIC
low complexity region 938 955 N/A INTRINSIC
low complexity region 958 974 N/A INTRINSIC
low complexity region 982 995 N/A INTRINSIC
Pfam:Endostatin 999 1315 8.2e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105409
SMART Domains Protein: ENSMUSP00000101049
Gene: ENSMUSG00000001435

DomainStartEndE-ValueType
Pfam:DUF959 16 219 3.6e-100 PFAM
TSPN 245 433 4.25e-72 SMART
LamG 294 432 2.17e-2 SMART
low complexity region 452 468 N/A INTRINSIC
low complexity region 472 487 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 542 613 N/A INTRINSIC
low complexity region 630 648 N/A INTRINSIC
low complexity region 674 695 N/A INTRINSIC
Pfam:Collagen 700 761 5.4e-9 PFAM
Pfam:Collagen 741 806 4e-8 PFAM
Pfam:Collagen 813 874 2.1e-10 PFAM
Pfam:Collagen 846 901 1.2e-7 PFAM
Pfam:Collagen 913 964 2.1e-7 PFAM
Pfam:Collagen 960 1020 2.6e-9 PFAM
low complexity region 1028 1041 N/A INTRINSIC
low complexity region 1054 1072 N/A INTRINSIC
low complexity region 1111 1146 N/A INTRINSIC
low complexity region 1150 1167 N/A INTRINSIC
low complexity region 1170 1186 N/A INTRINSIC
low complexity region 1194 1207 N/A INTRINSIC
Pfam:Endostatin 1211 1527 1.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149744
AA Change: G325S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116418
Gene: ENSMUSG00000001435
AA Change: G325S

DomainStartEndE-ValueType
Pfam:DUF959 16 219 1.6e-101 PFAM
low complexity region 295 307 N/A INTRINSIC
FRI 369 484 4.03e-47 SMART
Blast:TSPN 492 562 2e-40 BLAST
SCOP:d1saca_ 515 562 6e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XVIII collagen. This collagen is one of the multiplexins, extracellular matrix proteins that contain multiple triple-helix domains (collagenous domains) interrupted by non-collagenous domains. A long isoform of the protein has an N-terminal domain that is homologous to the extracellular part of frizzled receptors. Proteolytic processing at several endogenous cleavage sites in the C-terminal domain results in production of endostatin, a potent antiangiogenic protein that is able to inhibit angiogenesis and tumor growth. Mutations in this gene are associated with Knobloch syndrome. The main features of this syndrome involve retinal abnormalities, so type XVIII collagen may play an important role in retinal structure and in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in hyaloid vessel regression, attenuated visual function, abnormal electroretinograms, broad proximal tubule basement membrane, podocyte effacement, and softened glomeruli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A T 1: 138,852,108 Y135* probably null Het
2700081O15Rik T C 19: 7,422,244 I247T probably damaging Het
9430007A20Rik A T 4: 144,528,778 Y256F probably damaging Het
Acad10 A T 5: 121,629,927 I820K probably benign Het
Arl8b A T 6: 108,821,523 I178F possibly damaging Het
Asap1 A T 15: 64,135,804 probably null Het
Atp2b2 A T 6: 113,789,757 I552N possibly damaging Het
C130074G19Rik G T 1: 184,882,863 D43E probably benign Het
Ccdc162 C A 10: 41,555,972 probably null Het
Ccdc186 T G 19: 56,798,697 K613T possibly damaging Het
Cggbp1 T A 16: 64,855,683 D37E possibly damaging Het
Cntn3 A T 6: 102,337,383 N123K possibly damaging Het
Cwc25 G T 11: 97,747,392 T405K probably damaging Het
Cyp4a31 T C 4: 115,571,313 V370A possibly damaging Het
Cyp4f13 T G 17: 32,925,596 I309L probably benign Het
Dap3 A T 3: 88,933,563 probably null Het
Dchs1 G T 7: 105,754,094 D3080E probably benign Het
Ern2 A G 7: 122,171,508 V762A probably damaging Het
Fgr C T 4: 132,997,237 R255C probably damaging Het
Gcm2 A T 13: 41,103,618 D218E probably benign Het
Gfi1 A G 5: 107,721,774 S131P probably damaging Het
Grm8 A T 6: 28,126,119 C3S possibly damaging Het
Gucy2d A G 7: 98,464,019 D840G probably benign Het
H3f3a T C 1: 180,810,158 T81A probably benign Het
Igsf23 C T 7: 19,944,798 W22* probably null Het
Il12rb2 G A 6: 67,361,944 Q3* probably null Het
Ino80d A T 1: 63,085,835 L156H probably benign Het
Kdm2a G A 19: 4,329,126 P554S probably benign Het
Lefty1 T A 1: 180,937,242 L244H possibly damaging Het
Mdn1 T A 4: 32,750,010 S4398T probably benign Het
Myh10 A G 11: 68,793,139 D1126G probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myom1 A T 17: 71,034,579 D111V probably damaging Het
Naip6 T A 13: 100,283,661 D1367V probably damaging Het
Nbeal1 A T 1: 60,237,098 H666L possibly damaging Het
Nsmaf T A 4: 6,437,921 I77F probably damaging Het
Nvl T C 1: 181,130,792 T231A probably benign Het
Obscn T C 11: 59,112,612 R1287G probably damaging Het
Olfr1058 C T 2: 86,386,127 C97Y probably damaging Het
Olfr1219 C T 2: 89,074,399 G231S possibly damaging Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr2 A T 7: 107,001,676 Y61* probably null Het
Olfr420 T A 1: 174,158,920 V49D probably damaging Het
Olfr765 A G 10: 129,046,928 V45A probably benign Het
Opn3 T C 1: 175,692,511 D9G probably benign Het
Parp10 A T 15: 76,242,856 S101R probably benign Het
Pdhx T A 2: 103,024,217 K399* probably null Het
Pdia4 A T 6: 47,796,914 probably null Het
Pla2g4f T C 2: 120,300,442 D844G probably benign Het
Prtg C A 9: 72,856,824 D526E probably damaging Het
Rassf6 T C 5: 90,631,559 D5G probably benign Het
Riok3 C T 18: 12,149,667 Q388* probably null Het
Robo4 T A 9: 37,411,660 F825L probably benign Het
Rpl13a-ps1 C T 19: 50,030,429 E103K probably benign Het
Rpl18a A T 8: 70,896,220 H37Q probably benign Het
Ryr1 A T 7: 29,075,293 S2301T probably benign Het
Slc39a9 T A 12: 80,644,886 D2E possibly damaging Het
Slco5a1 C T 1: 12,989,934 V188I probably benign Het
Son T A 16: 91,657,659 M1098K probably damaging Het
Spag9 A G 11: 94,092,900 D701G probably damaging Het
Ssmem1 T C 6: 30,512,496 F46S possibly damaging Het
Sspo C T 6: 48,464,869 R1938W probably damaging Het
Sstr3 T C 15: 78,539,921 I209V probably benign Het
Tlk2 A G 11: 105,209,830 Y87C probably damaging Het
Traf4 G A 11: 78,160,176 R385W probably damaging Het
Triobp G A 15: 79,004,580 V1962M probably benign Het
Tspan12 T G 6: 21,835,507 I56L probably benign Het
Upp2 T A 2: 58,763,662 probably null Het
Vps13b T C 15: 35,869,311 W2654R probably damaging Het
Zc3h18 C T 8: 122,403,187 R435* probably null Het
Other mutations in Col18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Col18a1 APN 10 77069979 missense possibly damaging 0.93
IGL01023:Col18a1 APN 10 77070975 missense probably damaging 0.98
IGL01304:Col18a1 APN 10 77076141 unclassified probably benign
IGL01519:Col18a1 APN 10 77059323 missense probably damaging 0.99
IGL02217:Col18a1 APN 10 77053298 missense probably damaging 0.96
IGL02275:Col18a1 APN 10 77059383 missense possibly damaging 0.92
IGL02283:Col18a1 APN 10 77113109 missense possibly damaging 0.71
IGL02492:Col18a1 APN 10 77072021 splice site probably benign
IGL02673:Col18a1 APN 10 77059163 missense probably damaging 1.00
IGL02710:Col18a1 APN 10 77113312 missense possibly damaging 0.92
IGL02850:Col18a1 APN 10 77096466 missense probably damaging 0.98
IGL03085:Col18a1 APN 10 77059181 splice site probably benign
IGL03102:Col18a1 APN 10 77067623 splice site probably benign
IGL03139:Col18a1 APN 10 77113343 missense possibly damaging 0.84
IGL03181:Col18a1 APN 10 77055698 missense probably damaging 1.00
IGL03183:Col18a1 APN 10 77073754 missense probably damaging 1.00
R0039:Col18a1 UTSW 10 77077168 missense probably damaging 1.00
R0180:Col18a1 UTSW 10 77096517 missense probably benign 0.33
R0225:Col18a1 UTSW 10 77088914 missense possibly damaging 0.90
R0335:Col18a1 UTSW 10 77059363 missense probably damaging 0.99
R0336:Col18a1 UTSW 10 77058736 missense probably damaging 1.00
R1471:Col18a1 UTSW 10 77096206 missense unknown
R1538:Col18a1 UTSW 10 77071336 missense probably damaging 1.00
R1594:Col18a1 UTSW 10 77113036 missense possibly damaging 0.51
R1631:Col18a1 UTSW 10 77059297 missense probably damaging 0.99
R1774:Col18a1 UTSW 10 77059981 missense probably damaging 0.96
R1934:Col18a1 UTSW 10 77112744 missense possibly damaging 0.73
R1990:Col18a1 UTSW 10 77081154 missense unknown
R1991:Col18a1 UTSW 10 77081154 missense unknown
R1992:Col18a1 UTSW 10 77081154 missense unknown
R2081:Col18a1 UTSW 10 77054185 missense probably damaging 1.00
R2082:Col18a1 UTSW 10 77059293 missense probably damaging 1.00
R2510:Col18a1 UTSW 10 77096268 missense unknown
R3076:Col18a1 UTSW 10 77088928 missense possibly damaging 0.57
R3433:Col18a1 UTSW 10 77096268 missense unknown
R3800:Col18a1 UTSW 10 77067387 nonsense probably null
R3918:Col18a1 UTSW 10 77053358 missense probably benign 0.05
R3981:Col18a1 UTSW 10 77088887 missense probably damaging 0.99
R3983:Col18a1 UTSW 10 77088887 missense probably damaging 0.99
R4182:Col18a1 UTSW 10 77058841 splice site probably null
R4239:Col18a1 UTSW 10 77096167 missense unknown
R5014:Col18a1 UTSW 10 77070960 critical splice donor site probably null
R5107:Col18a1 UTSW 10 77077223 critical splice acceptor site probably null
R5413:Col18a1 UTSW 10 77069476 missense probably damaging 1.00
R5503:Col18a1 UTSW 10 77071620 missense probably damaging 1.00
R5524:Col18a1 UTSW 10 77058724 missense probably damaging 1.00
R5772:Col18a1 UTSW 10 77166343 missense unknown
R5958:Col18a1 UTSW 10 77096397 missense probably benign 0.01
R6280:Col18a1 UTSW 10 77112489 intron probably benign
R6309:Col18a1 UTSW 10 77112742 intron probably benign
R6603:Col18a1 UTSW 10 77063977 critical splice donor site probably null
R6608:Col18a1 UTSW 10 77112794 intron probably benign
R6805:Col18a1 UTSW 10 77054239 missense probably damaging 1.00
R6890:Col18a1 UTSW 10 77113484 intron probably benign
R6938:Col18a1 UTSW 10 77112499 intron probably benign
R7002:Col18a1 UTSW 10 77166343 missense unknown
R7154:Col18a1 UTSW 10 77072965 missense probably benign 0.25
R7204:Col18a1 UTSW 10 77085276 missense unknown
R7278:Col18a1 UTSW 10 77096284 missense unknown
R7442:Col18a1 UTSW 10 77096238 missense unknown
R7453:Col18a1 UTSW 10 77085210 intron probably null
R7597:Col18a1 UTSW 10 77113303 missense unknown
R7615:Col18a1 UTSW 10 77067005 missense probably damaging 1.00
R7671:Col18a1 UTSW 10 77085383 missense unknown
R7696:Col18a1 UTSW 10 77085272 missense unknown
R7719:Col18a1 UTSW 10 77078012 missense probably benign 0.13
R7772:Col18a1 UTSW 10 77068386 splice site probably null
R8077:Col18a1 UTSW 10 77080851 missense unknown
R8085:Col18a1 UTSW 10 77088907 missense unknown
R8097:Col18a1 UTSW 10 77112508 missense unknown
R8117:Col18a1 UTSW 10 77059974 missense probably benign 0.41
R8130:Col18a1 UTSW 10 77074450 missense probably benign 0.03
R8151:Col18a1 UTSW 10 77112584 missense unknown
R8379:Col18a1 UTSW 10 77053238 missense probably benign 0.08
Z1176:Col18a1 UTSW 10 77055709 missense possibly damaging 0.81
Z1176:Col18a1 UTSW 10 77112851 missense unknown
Z1177:Col18a1 UTSW 10 77112838 missense unknown
Predicted Primers PCR Primer
(F):5'- CTAAACGGCTGCAGAGAGTCAG -3'
(R):5'- TCTCTTCTCCACGGATCAGG -3'

Sequencing Primer
(F):5'- CTGCAGAGAGTCAGAGTGGGTG -3'
(R):5'- ACGGATCAGGGCTCCTC -3'
Posted On2014-10-30