Incidental Mutation 'R2351:Myh10'
ID246149
Institutional Source Beutler Lab
Gene Symbol Myh10
Ensembl Gene ENSMUSG00000020900
Gene Namemyosin, heavy polypeptide 10, non-muscle
SynonymsMyosin IIB, Fltn, Fltn, Myhn-2, myosin IIB, nonmuscle myosin heavy chain II-B, NMHC-B, Myhn2, SMemb, NMHC II-B, 5730504C04Rik, nonmuscle myosin heavy chain IIB, 9330167F11Rik
MMRRC Submission 040333-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2351 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location68691559-68816632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68793139 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1126 (D1126G)
Ref Sequence ENSEMBL: ENSMUSP00000099671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018887] [ENSMUST00000092984] [ENSMUST00000102611]
Predicted Effect probably damaging
Transcript: ENSMUST00000018887
AA Change: D1157G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018887
Gene: ENSMUSG00000020900
AA Change: D1157G

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.5e-15 PFAM
MYSc 79 815 N/A SMART
IQ 816 838 4.81e-4 SMART
low complexity region 932 946 N/A INTRINSIC
low complexity region 984 994 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1070 1086 N/A INTRINSIC
Pfam:Myosin_tail_1 1104 1961 6.5e-211 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092984
AA Change: D1163G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090661
Gene: ENSMUSG00000020900
AA Change: D1163G

DomainStartEndE-ValueType
Pfam:Myosin_N 70 110 2.5e-13 PFAM
MYSc 116 821 N/A SMART
IQ 822 844 4.81e-4 SMART
Pfam:Myosin_tail_1 885 1965 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102611
AA Change: D1126G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099671
Gene: ENSMUSG00000020900
AA Change: D1126G

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.4e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 4.81e-4 SMART
low complexity region 901 915 N/A INTRINSIC
low complexity region 953 963 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1039 1055 N/A INTRINSIC
Pfam:Myosin_tail_1 1073 1930 6.2e-211 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145408
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Nullizygous mice show pre- and neonatal death, heart defects and hydrocephaly. Deletion of exon B1 disrupts migration of facial neurons, whereas deletion of exon B2 leads to Purkinje cell anomalies. Hypomorphs show hydrocephaly and defects in motor control, cerebellar foliation and neuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A T 1: 138,852,108 Y135* probably null Het
2700081O15Rik T C 19: 7,422,244 I247T probably damaging Het
9430007A20Rik A T 4: 144,528,778 Y256F probably damaging Het
Acad10 A T 5: 121,629,927 I820K probably benign Het
Arl8b A T 6: 108,821,523 I178F possibly damaging Het
Asap1 A T 15: 64,135,804 probably null Het
Atp2b2 A T 6: 113,789,757 I552N possibly damaging Het
C130074G19Rik G T 1: 184,882,863 D43E probably benign Het
Ccdc162 C A 10: 41,555,972 probably null Het
Ccdc186 T G 19: 56,798,697 K613T possibly damaging Het
Cggbp1 T A 16: 64,855,683 D37E possibly damaging Het
Cntn3 A T 6: 102,337,383 N123K possibly damaging Het
Col18a1 C T 10: 77,112,704 G325S probably benign Het
Cwc25 G T 11: 97,747,392 T405K probably damaging Het
Cyp4a31 T C 4: 115,571,313 V370A possibly damaging Het
Cyp4f13 T G 17: 32,925,596 I309L probably benign Het
Dap3 A T 3: 88,933,563 probably null Het
Dchs1 G T 7: 105,754,094 D3080E probably benign Het
Ern2 A G 7: 122,171,508 V762A probably damaging Het
Fgr C T 4: 132,997,237 R255C probably damaging Het
Gcm2 A T 13: 41,103,618 D218E probably benign Het
Gfi1 A G 5: 107,721,774 S131P probably damaging Het
Grm8 A T 6: 28,126,119 C3S possibly damaging Het
Gucy2d A G 7: 98,464,019 D840G probably benign Het
H3f3a T C 1: 180,810,158 T81A probably benign Het
Igsf23 C T 7: 19,944,798 W22* probably null Het
Il12rb2 G A 6: 67,361,944 Q3* probably null Het
Ino80d A T 1: 63,085,835 L156H probably benign Het
Kdm2a G A 19: 4,329,126 P554S probably benign Het
Lefty1 T A 1: 180,937,242 L244H possibly damaging Het
Mdn1 T A 4: 32,750,010 S4398T probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myom1 A T 17: 71,034,579 D111V probably damaging Het
Naip6 T A 13: 100,283,661 D1367V probably damaging Het
Nbeal1 A T 1: 60,237,098 H666L possibly damaging Het
Nsmaf T A 4: 6,437,921 I77F probably damaging Het
Nvl T C 1: 181,130,792 T231A probably benign Het
Obscn T C 11: 59,112,612 R1287G probably damaging Het
Olfr1058 C T 2: 86,386,127 C97Y probably damaging Het
Olfr1219 C T 2: 89,074,399 G231S possibly damaging Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr2 A T 7: 107,001,676 Y61* probably null Het
Olfr420 T A 1: 174,158,920 V49D probably damaging Het
Olfr765 A G 10: 129,046,928 V45A probably benign Het
Opn3 T C 1: 175,692,511 D9G probably benign Het
Parp10 A T 15: 76,242,856 S101R probably benign Het
Pdhx T A 2: 103,024,217 K399* probably null Het
Pdia4 A T 6: 47,796,914 probably null Het
Pla2g4f T C 2: 120,300,442 D844G probably benign Het
Prtg C A 9: 72,856,824 D526E probably damaging Het
Rassf6 T C 5: 90,631,559 D5G probably benign Het
Riok3 C T 18: 12,149,667 Q388* probably null Het
Robo4 T A 9: 37,411,660 F825L probably benign Het
Rpl13a-ps1 C T 19: 50,030,429 E103K probably benign Het
Rpl18a A T 8: 70,896,220 H37Q probably benign Het
Ryr1 A T 7: 29,075,293 S2301T probably benign Het
Slc39a9 T A 12: 80,644,886 D2E possibly damaging Het
Slco5a1 C T 1: 12,989,934 V188I probably benign Het
Son T A 16: 91,657,659 M1098K probably damaging Het
Spag9 A G 11: 94,092,900 D701G probably damaging Het
Ssmem1 T C 6: 30,512,496 F46S possibly damaging Het
Sspo C T 6: 48,464,869 R1938W probably damaging Het
Sstr3 T C 15: 78,539,921 I209V probably benign Het
Tlk2 A G 11: 105,209,830 Y87C probably damaging Het
Traf4 G A 11: 78,160,176 R385W probably damaging Het
Triobp G A 15: 79,004,580 V1962M probably benign Het
Tspan12 T G 6: 21,835,507 I56L probably benign Het
Upp2 T A 2: 58,763,662 probably null Het
Vps13b T C 15: 35,869,311 W2654R probably damaging Het
Zc3h18 C T 8: 122,403,187 R435* probably null Het
Other mutations in Myh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myh10 APN 11 68790708 missense probably benign 0.10
IGL01132:Myh10 APN 11 68768268 missense possibly damaging 0.93
IGL01348:Myh10 APN 11 68811803 missense probably benign 0.04
IGL01404:Myh10 APN 11 68752040 splice site probably null
IGL01409:Myh10 APN 11 68807219 missense probably damaging 0.98
IGL01660:Myh10 APN 11 68785889 missense probably benign 0.00
IGL02111:Myh10 APN 11 68790112 missense probably damaging 1.00
IGL02481:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02483:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02502:Myh10 APN 11 68814372 splice site probably null
IGL03178:Myh10 APN 11 68699413 missense probably benign 0.19
algia UTSW 11 68802931 missense probably damaging 1.00
itis UTSW 11 68764245 missense probably damaging 0.96
PIT4802001:Myh10 UTSW 11 68765092 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0517:Myh10 UTSW 11 68811599 critical splice acceptor site probably null
R0855:Myh10 UTSW 11 68811801 missense possibly damaging 0.88
R1110:Myh10 UTSW 11 68791850 splice site probably benign
R1135:Myh10 UTSW 11 68807197 missense probably benign
R1169:Myh10 UTSW 11 68762841 missense probably damaging 0.99
R1643:Myh10 UTSW 11 68792010 missense probably damaging 0.96
R1733:Myh10 UTSW 11 68802296 missense probably benign 0.06
R1754:Myh10 UTSW 11 68813058 missense probably damaging 0.98
R1859:Myh10 UTSW 11 68745413 missense probably benign 0.03
R1898:Myh10 UTSW 11 68771906 missense probably damaging 1.00
R1905:Myh10 UTSW 11 68771868 splice site probably benign
R1914:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1915:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1987:Myh10 UTSW 11 68814496 missense possibly damaging 0.56
R2130:Myh10 UTSW 11 68807289 splice site probably benign
R2132:Myh10 UTSW 11 68807289 splice site probably benign
R2136:Myh10 UTSW 11 68804714 missense probably damaging 1.00
R2214:Myh10 UTSW 11 68783127 missense probably damaging 1.00
R3407:Myh10 UTSW 11 68790211 missense possibly damaging 0.68
R3721:Myh10 UTSW 11 68813052 missense probably damaging 0.99
R3908:Myh10 UTSW 11 68771059 critical splice donor site probably null
R4275:Myh10 UTSW 11 68751940 critical splice acceptor site probably null
R4526:Myh10 UTSW 11 68815049 missense probably benign 0.04
R4666:Myh10 UTSW 11 68801730 critical splice donor site probably null
R4668:Myh10 UTSW 11 68804642 missense probably damaging 1.00
R4750:Myh10 UTSW 11 68785314 missense probably damaging 1.00
R4968:Myh10 UTSW 11 68793223 missense probably damaging 1.00
R4977:Myh10 UTSW 11 68798371 missense possibly damaging 0.55
R5201:Myh10 UTSW 11 68783195 missense probably damaging 1.00
R5288:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5304:Myh10 UTSW 11 68764245 missense probably damaging 0.96
R5366:Myh10 UTSW 11 68760692 missense probably damaging 0.97
R5384:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5427:Myh10 UTSW 11 68802931 missense probably damaging 1.00
R5546:Myh10 UTSW 11 68798380 missense possibly damaging 0.90
R5551:Myh10 UTSW 11 68768287 missense possibly damaging 0.65
R5777:Myh10 UTSW 11 68785859 missense probably damaging 1.00
R5995:Myh10 UTSW 11 68814983 missense probably benign 0.01
R6021:Myh10 UTSW 11 68808862 missense possibly damaging 0.72
R6171:Myh10 UTSW 11 68791890 missense probably damaging 1.00
R6179:Myh10 UTSW 11 68802153 missense probably damaging 0.98
R6263:Myh10 UTSW 11 68810232 missense probably damaging 0.98
R6264:Myh10 UTSW 11 68745415 missense probably benign 0.01
R6484:Myh10 UTSW 11 68699467 missense probably damaging 1.00
R6575:Myh10 UTSW 11 68808850 missense probably benign 0.00
R6736:Myh10 UTSW 11 68745339 missense probably damaging 1.00
R7141:Myh10 UTSW 11 68802139 missense probably benign
R7256:Myh10 UTSW 11 68790689 missense probably damaging 1.00
R7329:Myh10 UTSW 11 68810191 missense probably benign 0.44
R7363:Myh10 UTSW 11 68815048 missense probably benign
R7576:Myh10 UTSW 11 68802166 missense probably damaging 1.00
R7577:Myh10 UTSW 11 68745980 missense unknown
R7681:Myh10 UTSW 11 68771936 missense probably damaging 0.98
R7813:Myh10 UTSW 11 68785909 missense probably benign 0.00
R7834:Myh10 UTSW 11 68785826 missense probably damaging 1.00
X0028:Myh10 UTSW 11 68793135 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCATTTACCTGGGAACCC -3'
(R):5'- GCTATTGATTGGAATGGCATCC -3'

Sequencing Primer
(F):5'- TGCACCCAACAGCCCCAG -3'
(R):5'- TGGAATGGCATCCAGTATGG -3'
Posted On2014-10-30