Incidental Mutation 'R2351:Tlk2'
ID246154
Institutional Source Beutler Lab
Gene Symbol Tlk2
Ensembl Gene ENSMUSG00000020694
Gene Nametousled-like kinase 2 (Arabidopsis)
Synonymsprotein kinase U-alpha, 4933403M19Rik, PKUalpha
MMRRC Submission 040333-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.785) question?
Stock #R2351 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location105178807-105283959 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105209830 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 87 (Y87C)
Ref Sequence ENSEMBL: ENSMUSP00000121897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015107] [ENSMUST00000092537] [ENSMUST00000106939] [ENSMUST00000106941] [ENSMUST00000126175] [ENSMUST00000145048] [ENSMUST00000149459]
Predicted Effect probably damaging
Transcript: ENSMUST00000015107
AA Change: Y87C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015107
Gene: ENSMUSG00000020694
AA Change: Y87C

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 202 237 N/A INTRINSIC
coiled coil region 285 314 N/A INTRINSIC
coiled coil region 355 393 N/A INTRINSIC
S_TKc 408 687 1.63e-78 SMART
low complexity region 696 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092537
AA Change: Y87C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090198
Gene: ENSMUSG00000020694
AA Change: Y87C

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
coiled coil region 234 269 N/A INTRINSIC
coiled coil region 317 346 N/A INTRINSIC
coiled coil region 387 425 N/A INTRINSIC
Pfam:Pkinase 440 675 9.4e-52 PFAM
Pfam:Pkinase_Tyr 441 669 3.5e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106939
AA Change: Y87C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102552
Gene: ENSMUSG00000020694
AA Change: Y87C

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 202 237 N/A INTRINSIC
coiled coil region 285 314 N/A INTRINSIC
coiled coil region 355 393 N/A INTRINSIC
S_TKc 408 687 1.63e-78 SMART
low complexity region 696 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106941
AA Change: Y87C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102554
Gene: ENSMUSG00000020694
AA Change: Y87C

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
coiled coil region 234 269 N/A INTRINSIC
coiled coil region 317 346 N/A INTRINSIC
coiled coil region 387 425 N/A INTRINSIC
S_TKc 440 719 1.63e-78 SMART
low complexity region 728 749 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126054
Predicted Effect probably benign
Transcript: ENSMUST00000126175
SMART Domains Protein: ENSMUSP00000120944
Gene: ENSMUSG00000020694

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145048
AA Change: Y87C

PolyPhen 2 Score 0.409 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118520
Gene: ENSMUSG00000020694
AA Change: Y87C

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 170 205 N/A INTRINSIC
coiled coil region 253 282 N/A INTRINSIC
coiled coil region 323 361 N/A INTRINSIC
Pfam:Pkinase 376 611 2.4e-51 PFAM
Pfam:Pkinase_Tyr 377 605 8.5e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149459
AA Change: Y87C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121897
Gene: ENSMUSG00000020694
AA Change: Y87C

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152404
AA Change: Y35C
SMART Domains Protein: ENSMUSP00000123179
Gene: ENSMUSG00000020694
AA Change: Y35C

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear serine/threonine kinase that was first identified in Arabidopsis. The encoded protein is thought to function in the regulation of chromatin assembly in the S phase of the cell cycle by regulating the levels of a histone H3/H4 chaperone. This protein is associated with double-strand break repair of DNA damage caused by radiation. Pseudogenes of this gene are present on chromosomes 10 and 17. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A T 1: 138,852,108 Y135* probably null Het
2700081O15Rik T C 19: 7,422,244 I247T probably damaging Het
9430007A20Rik A T 4: 144,528,778 Y256F probably damaging Het
Acad10 A T 5: 121,629,927 I820K probably benign Het
Arl8b A T 6: 108,821,523 I178F possibly damaging Het
Asap1 A T 15: 64,135,804 probably null Het
Atp2b2 A T 6: 113,789,757 I552N possibly damaging Het
C130074G19Rik G T 1: 184,882,863 D43E probably benign Het
Ccdc162 C A 10: 41,555,972 probably null Het
Ccdc186 T G 19: 56,798,697 K613T possibly damaging Het
Cggbp1 T A 16: 64,855,683 D37E possibly damaging Het
Cntn3 A T 6: 102,337,383 N123K possibly damaging Het
Col18a1 C T 10: 77,112,704 G325S probably benign Het
Cwc25 G T 11: 97,747,392 T405K probably damaging Het
Cyp4a31 T C 4: 115,571,313 V370A possibly damaging Het
Cyp4f13 T G 17: 32,925,596 I309L probably benign Het
Dap3 A T 3: 88,933,563 probably null Het
Dchs1 G T 7: 105,754,094 D3080E probably benign Het
Ern2 A G 7: 122,171,508 V762A probably damaging Het
Fgr C T 4: 132,997,237 R255C probably damaging Het
Gcm2 A T 13: 41,103,618 D218E probably benign Het
Gfi1 A G 5: 107,721,774 S131P probably damaging Het
Grm8 A T 6: 28,126,119 C3S possibly damaging Het
Gucy2d A G 7: 98,464,019 D840G probably benign Het
H3f3a T C 1: 180,810,158 T81A probably benign Het
Igsf23 C T 7: 19,944,798 W22* probably null Het
Il12rb2 G A 6: 67,361,944 Q3* probably null Het
Ino80d A T 1: 63,085,835 L156H probably benign Het
Kdm2a G A 19: 4,329,126 P554S probably benign Het
Lefty1 T A 1: 180,937,242 L244H possibly damaging Het
Mdn1 T A 4: 32,750,010 S4398T probably benign Het
Myh10 A G 11: 68,793,139 D1126G probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myom1 A T 17: 71,034,579 D111V probably damaging Het
Naip6 T A 13: 100,283,661 D1367V probably damaging Het
Nbeal1 A T 1: 60,237,098 H666L possibly damaging Het
Nsmaf T A 4: 6,437,921 I77F probably damaging Het
Nvl T C 1: 181,130,792 T231A probably benign Het
Obscn T C 11: 59,112,612 R1287G probably damaging Het
Olfr1058 C T 2: 86,386,127 C97Y probably damaging Het
Olfr1219 C T 2: 89,074,399 G231S possibly damaging Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr2 A T 7: 107,001,676 Y61* probably null Het
Olfr420 T A 1: 174,158,920 V49D probably damaging Het
Olfr765 A G 10: 129,046,928 V45A probably benign Het
Opn3 T C 1: 175,692,511 D9G probably benign Het
Parp10 A T 15: 76,242,856 S101R probably benign Het
Pdhx T A 2: 103,024,217 K399* probably null Het
Pdia4 A T 6: 47,796,914 probably null Het
Pla2g4f T C 2: 120,300,442 D844G probably benign Het
Prtg C A 9: 72,856,824 D526E probably damaging Het
Rassf6 T C 5: 90,631,559 D5G probably benign Het
Riok3 C T 18: 12,149,667 Q388* probably null Het
Robo4 T A 9: 37,411,660 F825L probably benign Het
Rpl13a-ps1 C T 19: 50,030,429 E103K probably benign Het
Rpl18a A T 8: 70,896,220 H37Q probably benign Het
Ryr1 A T 7: 29,075,293 S2301T probably benign Het
Slc39a9 T A 12: 80,644,886 D2E possibly damaging Het
Slco5a1 C T 1: 12,989,934 V188I probably benign Het
Son T A 16: 91,657,659 M1098K probably damaging Het
Spag9 A G 11: 94,092,900 D701G probably damaging Het
Ssmem1 T C 6: 30,512,496 F46S possibly damaging Het
Sspo C T 6: 48,464,869 R1938W probably damaging Het
Sstr3 T C 15: 78,539,921 I209V probably benign Het
Traf4 G A 11: 78,160,176 R385W probably damaging Het
Triobp G A 15: 79,004,580 V1962M probably benign Het
Tspan12 T G 6: 21,835,507 I56L probably benign Het
Upp2 T A 2: 58,763,662 probably null Het
Vps13b T C 15: 35,869,311 W2654R probably damaging Het
Zc3h18 C T 8: 122,403,187 R435* probably null Het
Other mutations in Tlk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Tlk2 APN 11 105246795 nonsense probably null
IGL00956:Tlk2 APN 11 105247592 missense probably benign 0.01
IGL01083:Tlk2 APN 11 105221224 missense probably benign 0.11
IGL02523:Tlk2 APN 11 105275947 missense probably damaging 0.99
IGL02694:Tlk2 APN 11 105221235 missense probably benign 0.19
H8786:Tlk2 UTSW 11 105254979 missense possibly damaging 0.93
PIT4378001:Tlk2 UTSW 11 105281220 missense unknown
R0310:Tlk2 UTSW 11 105254973 missense probably benign 0.15
R1457:Tlk2 UTSW 11 105256952 critical splice donor site probably null
R1505:Tlk2 UTSW 11 105260295 missense probably damaging 1.00
R1856:Tlk2 UTSW 11 105221298 missense probably benign 0.00
R2069:Tlk2 UTSW 11 105240440 missense probably benign 0.22
R2305:Tlk2 UTSW 11 105241591 missense possibly damaging 0.47
R3724:Tlk2 UTSW 11 105247564 missense probably benign 0.01
R4607:Tlk2 UTSW 11 105255018 missense probably damaging 1.00
R4641:Tlk2 UTSW 11 105275983 missense probably benign 0.41
R4738:Tlk2 UTSW 11 105256882 missense probably benign 0.22
R4803:Tlk2 UTSW 11 105281100 missense probably damaging 1.00
R4957:Tlk2 UTSW 11 105253359 critical splice donor site probably null
R5407:Tlk2 UTSW 11 105240375 missense probably damaging 0.98
R5551:Tlk2 UTSW 11 105221307 missense probably benign 0.05
R6456:Tlk2 UTSW 11 105221273 missense probably benign 0.05
R6922:Tlk2 UTSW 11 105256953 critical splice donor site probably null
R7183:Tlk2 UTSW 11 105221359 splice site probably null
R7265:Tlk2 UTSW 11 105184244 nonsense probably null
R7760:Tlk2 UTSW 11 105279167 missense probably damaging 1.00
R7797:Tlk2 UTSW 11 105210618 missense probably benign 0.00
R7823:Tlk2 UTSW 11 105253307 missense probably damaging 1.00
Z1177:Tlk2 UTSW 11 105184290 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCATCAGTGTTCATTTAGTCACTTG -3'
(R):5'- AAACCTGCAGCAGTCCTTC -3'

Sequencing Primer
(F):5'- ATAAGGTAATCTTAGTGTACGGGC -3'
(R):5'- GCAGTCCTTCTAATTACAAGATGGCC -3'
Posted On2014-10-30