Mutagenetix > Incidental Mutation

Incidental Mutation 'R2351:Myom1'

246169

Institutional Source

Beutler Lab

Gene Symbol

Myom1

Ensembl Gene

ENSMUSG00000024049

Gene Name

myomesin 1

Synonyms

skelemin, D430047A17Rik

MMRRC Submission

040333-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2351 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71019521-71126856 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 71034579 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 111 (D111V)

Ref Sequence

ENSEMBL: ENSMUSP00000024847 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]

AlphaFold

Q62234

Predicted Effect

probably damaging
Transcript: ENSMUST00000024847
AA Change: D111V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: D111V

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000073211
AA Change: D111V

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: D111V

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
low complexity region	857	870	N/A	INTRINSIC
FN3	916	1002	4.99e-11	SMART
FN3	1021	1106	2.04e-16	SMART
IG	1123	1208	3.1e0	SMART
IG_like	1231	1317	1.34e1	SMART
IG_like	1351	1417	4.79e0	SMART
IG_like	1454	1531	1.54e2	SMART
IGc2	1567	1635	2.05e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179759
AA Change: D111V

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: D111V

Domain	Start	End	E-Value	Type
low complexity region	62	94	N/A	INTRINSIC
low complexity region	188	210	N/A	INTRINSIC
low complexity region	228	244	N/A	INTRINSIC
IG	264	351	1.16e-8	SMART
IG	397	480	5.84e-5	SMART
FN3	490	573	4.48e-13	SMART
FN3	618	701	1.61e-14	SMART
FN3	719	800	1.43e-11	SMART
FN3	818	904	4.99e-11	SMART
FN3	923	1008	2.04e-16	SMART
IG	1025	1110	3.1e0	SMART
IG_like	1133	1219	1.34e1	SMART
IG_like	1253	1319	4.79e0	SMART
IG_like	1356	1433	1.54e2	SMART
IGc2	1469	1537	2.05e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180743

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310009B15Rik	A	T	1: 138,852,108	Y135*	probably null	Het
2700081O15Rik	T	C	19: 7,422,244	I247T	probably damaging	Het
9430007A20Rik	A	T	4: 144,528,778	Y256F	probably damaging	Het
Acad10	A	T	5: 121,629,927	I820K	probably benign	Het
Arl8b	A	T	6: 108,821,523	I178F	possibly damaging	Het
Asap1	A	T	15: 64,135,804		probably null	Het
Atp2b2	A	T	6: 113,789,757	I552N	possibly damaging	Het
C130074G19Rik	G	T	1: 184,882,863	D43E	probably benign	Het
Ccdc162	C	A	10: 41,555,972		probably null	Het
Ccdc186	T	G	19: 56,798,697	K613T	possibly damaging	Het
Cggbp1	T	A	16: 64,855,683	D37E	possibly damaging	Het
Cntn3	A	T	6: 102,337,383	N123K	possibly damaging	Het
Col18a1	C	T	10: 77,112,704	G325S	probably benign	Het
Cwc25	G	T	11: 97,747,392	T405K	probably damaging	Het
Cyp4a31	T	C	4: 115,571,313	V370A	possibly damaging	Het
Cyp4f13	T	G	17: 32,925,596	I309L	probably benign	Het
Dap3	A	T	3: 88,933,563		probably null	Het
Dchs1	G	T	7: 105,754,094	D3080E	probably benign	Het
Ern2	A	G	7: 122,171,508	V762A	probably damaging	Het
Fgr	C	T	4: 132,997,237	R255C	probably damaging	Het
Gcm2	A	T	13: 41,103,618	D218E	probably benign	Het
Gfi1	A	G	5: 107,721,774	S131P	probably damaging	Het
Grm8	A	T	6: 28,126,119	C3S	possibly damaging	Het
Gucy2d	A	G	7: 98,464,019	D840G	probably benign	Het
H3f3a	T	C	1: 180,810,158	T81A	probably benign	Het
Igsf23	C	T	7: 19,944,798	W22*	probably null	Het
Il12rb2	G	A	6: 67,361,944	Q3*	probably null	Het
Ino80d	A	T	1: 63,085,835	L156H	probably benign	Het
Kdm2a	G	A	19: 4,329,126	P554S	probably benign	Het
Lefty1	T	A	1: 180,937,242	L244H	possibly damaging	Het
Mdn1	T	A	4: 32,750,010	S4398T	probably benign	Het
Myh10	A	G	11: 68,793,139	D1126G	probably damaging	Het
Myo16	G	A	8: 10,594,905	D1746N	possibly damaging	Het
Naip6	T	A	13: 100,283,661	D1367V	probably damaging	Het
Nbeal1	A	T	1: 60,237,098	H666L	possibly damaging	Het
Nsmaf	T	A	4: 6,437,921	I77F	probably damaging	Het
Nvl	T	C	1: 181,130,792	T231A	probably benign	Het
Obscn	T	C	11: 59,112,612	R1287G	probably damaging	Het
Olfr1058	C	T	2: 86,386,127	C97Y	probably damaging	Het
Olfr1219	C	T	2: 89,074,399	G231S	possibly damaging	Het
Olfr1254	T	C	2: 89,789,178	Y58C	probably damaging	Het
Olfr2	A	T	7: 107,001,676	Y61*	probably null	Het
Olfr420	T	A	1: 174,158,920	V49D	probably damaging	Het
Olfr765	A	G	10: 129,046,928	V45A	probably benign	Het
Opn3	T	C	1: 175,692,511	D9G	probably benign	Het
Parp10	A	T	15: 76,242,856	S101R	probably benign	Het
Pdhx	T	A	2: 103,024,217	K399*	probably null	Het
Pdia4	A	T	6: 47,796,914		probably null	Het
Pla2g4f	T	C	2: 120,300,442	D844G	probably benign	Het
Prtg	C	A	9: 72,856,824	D526E	probably damaging	Het
Rassf6	T	C	5: 90,631,559	D5G	probably benign	Het
Riok3	C	T	18: 12,149,667	Q388*	probably null	Het
Robo4	T	A	9: 37,411,660	F825L	probably benign	Het
Rpl13a-ps1	C	T	19: 50,030,429	E103K	probably benign	Het
Rpl18a	A	T	8: 70,896,220	H37Q	probably benign	Het
Ryr1	A	T	7: 29,075,293	S2301T	probably benign	Het
Slc39a9	T	A	12: 80,644,886	D2E	possibly damaging	Het
Slco5a1	C	T	1: 12,989,934	V188I	probably benign	Het
Son	T	A	16: 91,657,659	M1098K	probably damaging	Het
Spag9	A	G	11: 94,092,900	D701G	probably damaging	Het
Ssmem1	T	C	6: 30,512,496	F46S	possibly damaging	Het
Sspo	C	T	6: 48,464,869	R1938W	probably damaging	Het
Sstr3	T	C	15: 78,539,921	I209V	probably benign	Het
Tlk2	A	G	11: 105,209,830	Y87C	probably damaging	Het
Traf4	G	A	11: 78,160,176	R385W	probably damaging	Het
Triobp	G	A	15: 79,004,580	V1962M	probably benign	Het
Tspan12	T	G	6: 21,835,507	I56L	probably benign	Het
Upp2	T	A	2: 58,763,662		probably null	Het
Vps13b	T	C	15: 35,869,311	W2654R	probably damaging	Het
Zc3h18	C	T	8: 122,403,187	R435*	probably null	Het

Other mutations in Myom1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Myom1	APN	17	71126098	missense	probably damaging	1.00
IGL00845:Myom1	APN	17	71084429	missense	probably damaging	1.00
IGL00904:Myom1	APN	17	71099949	splice site	probably benign
IGL00928:Myom1	APN	17	71089913	missense	probably damaging	1.00
IGL01025:Myom1	APN	17	71077917	missense	probably damaging	1.00
IGL01548:Myom1	APN	17	71101220	splice site	probably benign
IGL01588:Myom1	APN	17	71117437	missense	possibly damaging	0.94
IGL01614:Myom1	APN	17	71126178	missense	possibly damaging	0.46
IGL01618:Myom1	APN	17	71099993	missense	possibly damaging	0.87
IGL01619:Myom1	APN	17	71044476	splice site	probably benign
IGL01766:Myom1	APN	17	71077288	missense	probably damaging	1.00
IGL02105:Myom1	APN	17	71047716	splice site	probably benign
IGL02122:Myom1	APN	17	71092137	missense	probably damaging	1.00
IGL02184:Myom1	APN	17	71072137	missense	possibly damaging	0.93
IGL02260:Myom1	APN	17	71108315	nonsense	probably null
IGL02486:Myom1	APN	17	71099944	splice site	probably benign
IGL02501:Myom1	APN	17	71072081	critical splice acceptor site	probably null
IGL02642:Myom1	APN	17	71101098	missense	possibly damaging	0.90
IGL02677:Myom1	APN	17	71084349	missense	probably damaging	1.00
IGL02719:Myom1	APN	17	71106354	splice site	probably benign
IGL02945:Myom1	APN	17	71092093	splice site	probably benign
IGL03086:Myom1	APN	17	71108671	missense	probably damaging	1.00
IGL03218:Myom1	APN	17	71084316	missense	possibly damaging	0.46
R0107:Myom1	UTSW	17	71077365	missense	probably damaging	1.00
R0130:Myom1	UTSW	17	71045755	missense	probably damaging	0.98
R0133:Myom1	UTSW	17	71047787	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0206:Myom1	UTSW	17	71037297	missense	probably damaging	1.00
R0352:Myom1	UTSW	17	71045749	missense	possibly damaging	0.72
R0396:Myom1	UTSW	17	71034693	missense	probably damaging	1.00
R0496:Myom1	UTSW	17	71084306	missense	probably damaging	1.00
R0506:Myom1	UTSW	17	71092220	splice site	probably benign
R0511:Myom1	UTSW	17	71084317	missense	probably benign	0.22
R0600:Myom1	UTSW	17	71120648	missense	possibly damaging	0.48
R0699:Myom1	UTSW	17	71067313	missense	probably damaging	0.98
R0791:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0792:Myom1	UTSW	17	71121136	missense	probably damaging	1.00
R0963:Myom1	UTSW	17	71077767	missense	possibly damaging	0.74
R1324:Myom1	UTSW	17	71052719	missense	probably damaging	0.98
R2102:Myom1	UTSW	17	71101029	missense	probably damaging	1.00
R2158:Myom1	UTSW	17	71064597	missense	possibly damaging	0.83
R2336:Myom1	UTSW	17	71023194	missense	possibly damaging	0.53
R2442:Myom1	UTSW	17	71110735	missense	probably damaging	1.00
R2483:Myom1	UTSW	17	71077812	missense	probably damaging	1.00
R2892:Myom1	UTSW	17	71034653	missense	probably damaging	1.00
R2897:Myom1	UTSW	17	71101220	splice site	probably benign
R3440:Myom1	UTSW	17	71045663	splice site	probably null
R3842:Myom1	UTSW	17	71045624	missense	probably damaging	1.00
R4249:Myom1	UTSW	17	71092140	missense	probably damaging	1.00
R4329:Myom1	UTSW	17	71036353	missense	probably damaging	1.00
R4594:Myom1	UTSW	17	71100074	missense	possibly damaging	0.73
R4873:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4875:Myom1	UTSW	17	71072119	missense	probably damaging	1.00
R4876:Myom1	UTSW	17	71077410	missense	probably damaging	1.00
R5171:Myom1	UTSW	17	71099972	missense	possibly damaging	0.94
R5540:Myom1	UTSW	17	71109787	missense	probably damaging	1.00
R5882:Myom1	UTSW	17	71110722	missense	probably damaging	1.00
R5978:Myom1	UTSW	17	71117443	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6039:Myom1	UTSW	17	71110751	missense	probably damaging	1.00
R6155:Myom1	UTSW	17	71108695	critical splice donor site	probably null
R6261:Myom1	UTSW	17	71126137	missense	probably damaging	1.00
R6284:Myom1	UTSW	17	71022892	nonsense	probably null
R6313:Myom1	UTSW	17	71082488	missense	probably benign
R6369:Myom1	UTSW	17	71101076	missense	probably damaging	1.00
R6545:Myom1	UTSW	17	71082305	missense	probably benign	0.00
R6738:Myom1	UTSW	17	71100398	splice site	probably null
R6933:Myom1	UTSW	17	71052671	missense	probably damaging	1.00
R7168:Myom1	UTSW	17	71089947	missense	probably benign	0.00
R7286:Myom1	UTSW	17	71045549	missense	possibly damaging	0.90
R7315:Myom1	UTSW	17	71080897	critical splice donor site	probably null
R7672:Myom1	UTSW	17	71084240	missense	possibly damaging	0.92
R7789:Myom1	UTSW	17	71117436	missense	probably benign	0.03
R7898:Myom1	UTSW	17	71045752	missense	probably benign	0.25
R8008:Myom1	UTSW	17	71100062	missense	probably benign	0.30
R8152:Myom1	UTSW	17	71084295	missense	probably damaging	0.96
R8554:Myom1	UTSW	17	71036453	missense	possibly damaging	0.94
R8874:Myom1	UTSW	17	71106204	missense	probably damaging	1.00
R8981:Myom1	UTSW	17	71084321	missense	probably benign	0.09
R9012:Myom1	UTSW	17	71100108	missense	probably benign	0.06
R9090:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9193:Myom1	UTSW	17	71036300	missense	probably damaging	1.00
R9237:Myom1	UTSW	17	71101056	missense	probably damaging	1.00
R9271:Myom1	UTSW	17	71067330	missense	probably damaging	1.00
R9355:Myom1	UTSW	17	71077893	missense	probably damaging	1.00
R9362:Myom1	UTSW	17	71036293	missense	probably benign	0.00
R9440:Myom1	UTSW	17	71126334	missense	probably benign	0.00
R9469:Myom1	UTSW	17	71061127	missense	possibly damaging	0.79
R9568:Myom1	UTSW	17	71087481	missense	probably damaging	1.00
X0019:Myom1	UTSW	17	71100071	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- ACCGATTTTCCTGAGTGTCTG -3'
(R):5'- CTCGCTTATCAGAACTACACGCAG -3'

Sequencing Primer
(F):5'- CCTGAGTGTCTGTCTAGAATCCG -3'
(R):5'- CTTATCAGAACTACACGCAGGAAGAG -3'

Posted On

2014-10-30