Incidental Mutation 'R2351:Myom1'
ID 246169
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Name myomesin 1
Synonyms skelemin, D430047A17Rik
MMRRC Submission 040333-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2351 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 71019521-71126856 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71034579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 111 (D111V)
Ref Sequence ENSEMBL: ENSMUSP00000024847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
AlphaFold Q62234
Predicted Effect probably damaging
Transcript: ENSMUST00000024847
AA Change: D111V

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: D111V

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073211
AA Change: D111V

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: D111V

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179759
AA Change: D111V

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: D111V

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A T 1: 138,852,108 (GRCm38) Y135* probably null Het
2700081O15Rik T C 19: 7,422,244 (GRCm38) I247T probably damaging Het
9430007A20Rik A T 4: 144,528,778 (GRCm38) Y256F probably damaging Het
Acad10 A T 5: 121,629,927 (GRCm38) I820K probably benign Het
Arl8b A T 6: 108,821,523 (GRCm38) I178F possibly damaging Het
Asap1 A T 15: 64,135,804 (GRCm38) probably null Het
Atp2b2 A T 6: 113,789,757 (GRCm38) I552N possibly damaging Het
C130074G19Rik G T 1: 184,882,863 (GRCm38) D43E probably benign Het
Ccdc162 C A 10: 41,555,972 (GRCm38) probably null Het
Ccdc186 T G 19: 56,798,697 (GRCm38) K613T possibly damaging Het
Cggbp1 T A 16: 64,855,683 (GRCm38) D37E possibly damaging Het
Cntn3 A T 6: 102,337,383 (GRCm38) N123K possibly damaging Het
Col18a1 C T 10: 77,112,704 (GRCm38) G325S probably benign Het
Cwc25 G T 11: 97,747,392 (GRCm38) T405K probably damaging Het
Cyp4a31 T C 4: 115,571,313 (GRCm38) V370A possibly damaging Het
Cyp4f13 T G 17: 32,925,596 (GRCm38) I309L probably benign Het
Dap3 A T 3: 88,933,563 (GRCm38) probably null Het
Dchs1 G T 7: 105,754,094 (GRCm38) D3080E probably benign Het
Ern2 A G 7: 122,171,508 (GRCm38) V762A probably damaging Het
Fgr C T 4: 132,997,237 (GRCm38) R255C probably damaging Het
Gcm2 A T 13: 41,103,618 (GRCm38) D218E probably benign Het
Gfi1 A G 5: 107,721,774 (GRCm38) S131P probably damaging Het
Grm8 A T 6: 28,126,119 (GRCm38) C3S possibly damaging Het
Gucy2d A G 7: 98,464,019 (GRCm38) D840G probably benign Het
H3f3a T C 1: 180,810,158 (GRCm38) T81A probably benign Het
Igsf23 C T 7: 19,944,798 (GRCm38) W22* probably null Het
Il12rb2 G A 6: 67,361,944 (GRCm38) Q3* probably null Het
Ino80d A T 1: 63,085,835 (GRCm38) L156H probably benign Het
Kdm2a G A 19: 4,329,126 (GRCm38) P554S probably benign Het
Lefty1 T A 1: 180,937,242 (GRCm38) L244H possibly damaging Het
Mdn1 T A 4: 32,750,010 (GRCm38) S4398T probably benign Het
Myh10 A G 11: 68,793,139 (GRCm38) D1126G probably damaging Het
Myo16 G A 8: 10,594,905 (GRCm38) D1746N possibly damaging Het
Naip6 T A 13: 100,283,661 (GRCm38) D1367V probably damaging Het
Nbeal1 A T 1: 60,237,098 (GRCm38) H666L possibly damaging Het
Nsmaf T A 4: 6,437,921 (GRCm38) I77F probably damaging Het
Nvl T C 1: 181,130,792 (GRCm38) T231A probably benign Het
Obscn T C 11: 59,112,612 (GRCm38) R1287G probably damaging Het
Olfr1058 C T 2: 86,386,127 (GRCm38) C97Y probably damaging Het
Olfr1219 C T 2: 89,074,399 (GRCm38) G231S possibly damaging Het
Olfr1254 T C 2: 89,789,178 (GRCm38) Y58C probably damaging Het
Olfr2 A T 7: 107,001,676 (GRCm38) Y61* probably null Het
Olfr420 T A 1: 174,158,920 (GRCm38) V49D probably damaging Het
Olfr765 A G 10: 129,046,928 (GRCm38) V45A probably benign Het
Opn3 T C 1: 175,692,511 (GRCm38) D9G probably benign Het
Parp10 A T 15: 76,242,856 (GRCm38) S101R probably benign Het
Pdhx T A 2: 103,024,217 (GRCm38) K399* probably null Het
Pdia4 A T 6: 47,796,914 (GRCm38) probably null Het
Pla2g4f T C 2: 120,300,442 (GRCm38) D844G probably benign Het
Prtg C A 9: 72,856,824 (GRCm38) D526E probably damaging Het
Rassf6 T C 5: 90,631,559 (GRCm38) D5G probably benign Het
Riok3 C T 18: 12,149,667 (GRCm38) Q388* probably null Het
Robo4 T A 9: 37,411,660 (GRCm38) F825L probably benign Het
Rpl13a-ps1 C T 19: 50,030,429 (GRCm38) E103K probably benign Het
Rpl18a A T 8: 70,896,220 (GRCm38) H37Q probably benign Het
Ryr1 A T 7: 29,075,293 (GRCm38) S2301T probably benign Het
Slc39a9 T A 12: 80,644,886 (GRCm38) D2E possibly damaging Het
Slco5a1 C T 1: 12,989,934 (GRCm38) V188I probably benign Het
Son T A 16: 91,657,659 (GRCm38) M1098K probably damaging Het
Spag9 A G 11: 94,092,900 (GRCm38) D701G probably damaging Het
Ssmem1 T C 6: 30,512,496 (GRCm38) F46S possibly damaging Het
Sspo C T 6: 48,464,869 (GRCm38) R1938W probably damaging Het
Sstr3 T C 15: 78,539,921 (GRCm38) I209V probably benign Het
Tlk2 A G 11: 105,209,830 (GRCm38) Y87C probably damaging Het
Traf4 G A 11: 78,160,176 (GRCm38) R385W probably damaging Het
Triobp G A 15: 79,004,580 (GRCm38) V1962M probably benign Het
Tspan12 T G 6: 21,835,507 (GRCm38) I56L probably benign Het
Upp2 T A 2: 58,763,662 (GRCm38) probably null Het
Vps13b T C 15: 35,869,311 (GRCm38) W2654R probably damaging Het
Zc3h18 C T 8: 122,403,187 (GRCm38) R435* probably null Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71,126,098 (GRCm38) missense probably damaging 1.00
IGL00845:Myom1 APN 17 71,084,429 (GRCm38) missense probably damaging 1.00
IGL00904:Myom1 APN 17 71,099,949 (GRCm38) splice site probably benign
IGL00928:Myom1 APN 17 71,089,913 (GRCm38) missense probably damaging 1.00
IGL01025:Myom1 APN 17 71,077,917 (GRCm38) missense probably damaging 1.00
IGL01548:Myom1 APN 17 71,101,220 (GRCm38) splice site probably benign
IGL01588:Myom1 APN 17 71,117,437 (GRCm38) missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71,126,178 (GRCm38) missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71,099,993 (GRCm38) missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71,044,476 (GRCm38) splice site probably benign
IGL01766:Myom1 APN 17 71,077,288 (GRCm38) missense probably damaging 1.00
IGL02105:Myom1 APN 17 71,047,716 (GRCm38) splice site probably benign
IGL02122:Myom1 APN 17 71,092,137 (GRCm38) missense probably damaging 1.00
IGL02184:Myom1 APN 17 71,072,137 (GRCm38) missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71,108,315 (GRCm38) nonsense probably null
IGL02486:Myom1 APN 17 71,099,944 (GRCm38) splice site probably benign
IGL02501:Myom1 APN 17 71,072,081 (GRCm38) critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71,101,098 (GRCm38) missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71,084,349 (GRCm38) missense probably damaging 1.00
IGL02719:Myom1 APN 17 71,106,354 (GRCm38) splice site probably benign
IGL02945:Myom1 APN 17 71,092,093 (GRCm38) splice site probably benign
IGL03086:Myom1 APN 17 71,108,671 (GRCm38) missense probably damaging 1.00
IGL03218:Myom1 APN 17 71,084,316 (GRCm38) missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71,077,365 (GRCm38) missense probably damaging 1.00
R0130:Myom1 UTSW 17 71,045,755 (GRCm38) missense probably damaging 0.98
R0133:Myom1 UTSW 17 71,047,787 (GRCm38) missense probably damaging 1.00
R0206:Myom1 UTSW 17 71,037,297 (GRCm38) missense probably damaging 1.00
R0206:Myom1 UTSW 17 71,037,297 (GRCm38) missense probably damaging 1.00
R0352:Myom1 UTSW 17 71,045,749 (GRCm38) missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71,034,693 (GRCm38) missense probably damaging 1.00
R0496:Myom1 UTSW 17 71,084,306 (GRCm38) missense probably damaging 1.00
R0506:Myom1 UTSW 17 71,092,220 (GRCm38) splice site probably benign
R0511:Myom1 UTSW 17 71,084,317 (GRCm38) missense probably benign 0.22
R0600:Myom1 UTSW 17 71,120,648 (GRCm38) missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71,067,313 (GRCm38) missense probably damaging 0.98
R0791:Myom1 UTSW 17 71,121,136 (GRCm38) missense probably damaging 1.00
R0792:Myom1 UTSW 17 71,121,136 (GRCm38) missense probably damaging 1.00
R0963:Myom1 UTSW 17 71,077,767 (GRCm38) missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71,052,719 (GRCm38) missense probably damaging 0.98
R2102:Myom1 UTSW 17 71,101,029 (GRCm38) missense probably damaging 1.00
R2158:Myom1 UTSW 17 71,064,597 (GRCm38) missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71,023,194 (GRCm38) missense possibly damaging 0.53
R2442:Myom1 UTSW 17 71,110,735 (GRCm38) missense probably damaging 1.00
R2483:Myom1 UTSW 17 71,077,812 (GRCm38) missense probably damaging 1.00
R2892:Myom1 UTSW 17 71,034,653 (GRCm38) missense probably damaging 1.00
R2897:Myom1 UTSW 17 71,101,220 (GRCm38) splice site probably benign
R3440:Myom1 UTSW 17 71,045,663 (GRCm38) splice site probably null
R3842:Myom1 UTSW 17 71,045,624 (GRCm38) missense probably damaging 1.00
R4249:Myom1 UTSW 17 71,092,140 (GRCm38) missense probably damaging 1.00
R4329:Myom1 UTSW 17 71,036,353 (GRCm38) missense probably damaging 1.00
R4594:Myom1 UTSW 17 71,100,074 (GRCm38) missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71,072,119 (GRCm38) missense probably damaging 1.00
R4875:Myom1 UTSW 17 71,072,119 (GRCm38) missense probably damaging 1.00
R4876:Myom1 UTSW 17 71,077,410 (GRCm38) missense probably damaging 1.00
R5171:Myom1 UTSW 17 71,099,972 (GRCm38) missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71,109,787 (GRCm38) missense probably damaging 1.00
R5882:Myom1 UTSW 17 71,110,722 (GRCm38) missense probably damaging 1.00
R5978:Myom1 UTSW 17 71,117,443 (GRCm38) missense probably damaging 1.00
R6039:Myom1 UTSW 17 71,110,751 (GRCm38) missense probably damaging 1.00
R6039:Myom1 UTSW 17 71,110,751 (GRCm38) missense probably damaging 1.00
R6155:Myom1 UTSW 17 71,108,695 (GRCm38) critical splice donor site probably null
R6261:Myom1 UTSW 17 71,126,137 (GRCm38) missense probably damaging 1.00
R6284:Myom1 UTSW 17 71,022,892 (GRCm38) nonsense probably null
R6313:Myom1 UTSW 17 71,082,488 (GRCm38) missense probably benign
R6369:Myom1 UTSW 17 71,101,076 (GRCm38) missense probably damaging 1.00
R6545:Myom1 UTSW 17 71,082,305 (GRCm38) missense probably benign 0.00
R6738:Myom1 UTSW 17 71,100,398 (GRCm38) splice site probably null
R6933:Myom1 UTSW 17 71,052,671 (GRCm38) missense probably damaging 1.00
R7168:Myom1 UTSW 17 71,089,947 (GRCm38) missense probably benign 0.00
R7286:Myom1 UTSW 17 71,045,549 (GRCm38) missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71,080,897 (GRCm38) critical splice donor site probably null
R7672:Myom1 UTSW 17 71,084,240 (GRCm38) missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71,117,436 (GRCm38) missense probably benign 0.03
R7898:Myom1 UTSW 17 71,045,752 (GRCm38) missense probably benign 0.25
R8008:Myom1 UTSW 17 71,100,062 (GRCm38) missense probably benign 0.30
R8152:Myom1 UTSW 17 71,084,295 (GRCm38) missense probably damaging 0.96
R8554:Myom1 UTSW 17 71,036,453 (GRCm38) missense possibly damaging 0.94
R8874:Myom1 UTSW 17 71,106,204 (GRCm38) missense probably damaging 1.00
R8981:Myom1 UTSW 17 71,084,321 (GRCm38) missense probably benign 0.09
R9012:Myom1 UTSW 17 71,100,108 (GRCm38) missense probably benign 0.06
R9090:Myom1 UTSW 17 71,067,330 (GRCm38) missense probably damaging 1.00
R9193:Myom1 UTSW 17 71,036,300 (GRCm38) missense probably damaging 1.00
R9237:Myom1 UTSW 17 71,101,056 (GRCm38) missense probably damaging 1.00
R9271:Myom1 UTSW 17 71,067,330 (GRCm38) missense probably damaging 1.00
R9355:Myom1 UTSW 17 71,077,893 (GRCm38) missense probably damaging 1.00
R9362:Myom1 UTSW 17 71,036,293 (GRCm38) missense probably benign 0.00
R9440:Myom1 UTSW 17 71,126,334 (GRCm38) missense probably benign 0.00
R9469:Myom1 UTSW 17 71,061,127 (GRCm38) missense possibly damaging 0.79
R9568:Myom1 UTSW 17 71,087,481 (GRCm38) missense probably damaging 1.00
R9612:Myom1 UTSW 17 71,105,480 (GRCm38) nonsense probably null
R9645:Myom1 UTSW 17 71,092,209 (GRCm38) missense probably benign 0.01
X0019:Myom1 UTSW 17 71,100,071 (GRCm38) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACCGATTTTCCTGAGTGTCTG -3'
(R):5'- CTCGCTTATCAGAACTACACGCAG -3'

Sequencing Primer
(F):5'- CCTGAGTGTCTGTCTAGAATCCG -3'
(R):5'- CTTATCAGAACTACACGCAGGAAGAG -3'
Posted On 2014-10-30