Incidental Mutation 'R2351:2700081O15Rik'
List |< first << previous [record 2 of 71] next >> last >|
ID246174
Institutional Source Beutler Lab
Gene Symbol 2700081O15Rik
Ensembl Gene ENSMUSG00000053080
Gene NameRIKEN cDNA 2700081O15 gene
Synonyms
MMRRC Submission 040333-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2351 (G1)
Quality Score187
Status Not validated
Chromosome19
Chromosomal Location7417625-7425904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7422244 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 247 (I247T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025667] [ENSMUST00000065304] [ENSMUST00000088169] [ENSMUST00000088171] [ENSMUST00000159348] [ENSMUST00000161907]
Predicted Effect probably benign
Transcript: ENSMUST00000025667
SMART Domains Protein: ENSMUSP00000025667
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
Pfam:Reticulon 49 219 8.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065304
SMART Domains Protein: ENSMUSP00000065810
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
low complexity region 639 650 N/A INTRINSIC
Pfam:Reticulon 776 940 9.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088169
SMART Domains Protein: ENSMUSP00000085494
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
Pfam:Reticulon 68 238 1.1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088171
SMART Domains Protein: ENSMUSP00000085496
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 56 N/A INTRINSIC
low complexity region 61 72 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Pfam:Reticulon 757 927 1.8e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159346
AA Change: I247T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124442
Gene: ENSMUSG00000053080
AA Change: I247T

DomainStartEndE-ValueType
coiled coil region 14 41 N/A INTRINSIC
low complexity region 42 67 N/A INTRINSIC
low complexity region 72 97 N/A INTRINSIC
low complexity region 178 215 N/A INTRINSIC
ZnF_C2H2 231 256 2.06e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159348
AA Change: I452T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123773
Gene: ENSMUSG00000053080
AA Change: I452T

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
ZnF_C2H2 124 149 3.38e1 SMART
low complexity region 171 201 N/A INTRINSIC
low complexity region 205 230 N/A INTRINSIC
low complexity region 235 260 N/A INTRINSIC
ZnF_C2H2 283 308 1.06e2 SMART
low complexity region 382 419 N/A INTRINSIC
ZnF_C2H2 435 460 2.06e1 SMART
low complexity region 491 522 N/A INTRINSIC
low complexity region 540 547 N/A INTRINSIC
low complexity region 557 572 N/A INTRINSIC
ZnF_C2H2 600 625 2.54e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160561
SMART Domains Protein: ENSMUSP00000124645
Gene: ENSMUSG00000053080

DomainStartEndE-ValueType
ZnF_C2H2 10 35 1.06e2 SMART
low complexity region 109 146 N/A INTRINSIC
ZnF_C2H2 162 187 2.06e1 SMART
low complexity region 218 249 N/A INTRINSIC
low complexity region 267 274 N/A INTRINSIC
low complexity region 284 299 N/A INTRINSIC
ZnF_C2H2 327 352 2.54e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161907
SMART Domains Protein: ENSMUSP00000139847
Gene: ENSMUSG00000053080

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
ZnF_C2H2 70 95 1.4e-1 SMART
coiled coil region 124 151 N/A INTRINSIC
low complexity region 173 180 N/A INTRINSIC
low complexity region 190 205 N/A INTRINSIC
ZnF_C2H2 233 258 1.1e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189779
Predicted Effect probably benign
Transcript: ENSMUST00000191580
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A T 1: 138,852,108 Y135* probably null Het
9430007A20Rik A T 4: 144,528,778 Y256F probably damaging Het
Acad10 A T 5: 121,629,927 I820K probably benign Het
Arl8b A T 6: 108,821,523 I178F possibly damaging Het
Asap1 A T 15: 64,135,804 probably null Het
Atp2b2 A T 6: 113,789,757 I552N possibly damaging Het
C130074G19Rik G T 1: 184,882,863 D43E probably benign Het
Ccdc162 C A 10: 41,555,972 probably null Het
Ccdc186 T G 19: 56,798,697 K613T possibly damaging Het
Cggbp1 T A 16: 64,855,683 D37E possibly damaging Het
Cntn3 A T 6: 102,337,383 N123K possibly damaging Het
Col18a1 C T 10: 77,112,704 G325S probably benign Het
Cwc25 G T 11: 97,747,392 T405K probably damaging Het
Cyp4a31 T C 4: 115,571,313 V370A possibly damaging Het
Cyp4f13 T G 17: 32,925,596 I309L probably benign Het
Dap3 A T 3: 88,933,563 probably null Het
Dchs1 G T 7: 105,754,094 D3080E probably benign Het
Ern2 A G 7: 122,171,508 V762A probably damaging Het
Fgr C T 4: 132,997,237 R255C probably damaging Het
Gcm2 A T 13: 41,103,618 D218E probably benign Het
Gfi1 A G 5: 107,721,774 S131P probably damaging Het
Grm8 A T 6: 28,126,119 C3S possibly damaging Het
Gucy2d A G 7: 98,464,019 D840G probably benign Het
H3f3a T C 1: 180,810,158 T81A probably benign Het
Igsf23 C T 7: 19,944,798 W22* probably null Het
Il12rb2 G A 6: 67,361,944 Q3* probably null Het
Ino80d A T 1: 63,085,835 L156H probably benign Het
Kdm2a G A 19: 4,329,126 P554S probably benign Het
Lefty1 T A 1: 180,937,242 L244H possibly damaging Het
Mdn1 T A 4: 32,750,010 S4398T probably benign Het
Myh10 A G 11: 68,793,139 D1126G probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myom1 A T 17: 71,034,579 D111V probably damaging Het
Naip6 T A 13: 100,283,661 D1367V probably damaging Het
Nbeal1 A T 1: 60,237,098 H666L possibly damaging Het
Nsmaf T A 4: 6,437,921 I77F probably damaging Het
Nvl T C 1: 181,130,792 T231A probably benign Het
Obscn T C 11: 59,112,612 R1287G probably damaging Het
Olfr1058 C T 2: 86,386,127 C97Y probably damaging Het
Olfr1219 C T 2: 89,074,399 G231S possibly damaging Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr2 A T 7: 107,001,676 Y61* probably null Het
Olfr420 T A 1: 174,158,920 V49D probably damaging Het
Olfr765 A G 10: 129,046,928 V45A probably benign Het
Opn3 T C 1: 175,692,511 D9G probably benign Het
Parp10 A T 15: 76,242,856 S101R probably benign Het
Pdhx T A 2: 103,024,217 K399* probably null Het
Pdia4 A T 6: 47,796,914 probably null Het
Pla2g4f T C 2: 120,300,442 D844G probably benign Het
Prtg C A 9: 72,856,824 D526E probably damaging Het
Rassf6 T C 5: 90,631,559 D5G probably benign Het
Riok3 C T 18: 12,149,667 Q388* probably null Het
Robo4 T A 9: 37,411,660 F825L probably benign Het
Rpl13a-ps1 C T 19: 50,030,429 E103K probably benign Het
Rpl18a A T 8: 70,896,220 H37Q probably benign Het
Ryr1 A T 7: 29,075,293 S2301T probably benign Het
Slc39a9 T A 12: 80,644,886 D2E possibly damaging Het
Slco5a1 C T 1: 12,989,934 V188I probably benign Het
Son T A 16: 91,657,659 M1098K probably damaging Het
Spag9 A G 11: 94,092,900 D701G probably damaging Het
Ssmem1 T C 6: 30,512,496 F46S possibly damaging Het
Sspo C T 6: 48,464,869 R1938W probably damaging Het
Sstr3 T C 15: 78,539,921 I209V probably benign Het
Tlk2 A G 11: 105,209,830 Y87C probably damaging Het
Traf4 G A 11: 78,160,176 R385W probably damaging Het
Triobp G A 15: 79,004,580 V1962M probably benign Het
Tspan12 T G 6: 21,835,507 I56L probably benign Het
Upp2 T A 2: 58,763,662 probably null Het
Vps13b T C 15: 35,869,311 W2654R probably damaging Het
Zc3h18 C T 8: 122,403,187 R435* probably null Het
Other mutations in 2700081O15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02376:2700081O15Rik APN 19 7422376 missense probably damaging 1.00
IGL02814:2700081O15Rik APN 19 7420422 missense possibly damaging 0.94
H8562:2700081O15Rik UTSW 19 7422921 missense probably benign 0.01
R0034:2700081O15Rik UTSW 19 7420359 missense probably damaging 1.00
R0583:2700081O15Rik UTSW 19 7420274 missense probably damaging 1.00
R4326:2700081O15Rik UTSW 19 7421226 intron probably benign
R4329:2700081O15Rik UTSW 19 7421226 intron probably benign
R5474:2700081O15Rik UTSW 19 7420159 missense probably damaging 1.00
R5735:2700081O15Rik UTSW 19 7422796 missense probably benign
R6168:2700081O15Rik UTSW 19 7422940 missense probably benign 0.40
R6739:2700081O15Rik UTSW 19 7421347 nonsense probably null
R7780:2700081O15Rik UTSW 19 7422372 missense probably damaging 0.96
R7855:2700081O15Rik UTSW 19 7422256 missense probably damaging 1.00
Z1176:2700081O15Rik UTSW 19 7422747 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGTAAGGACAACACAGCC -3'
(R):5'- AGCGAGTGCCATCAATCAGG -3'

Sequencing Primer
(F):5'- CCTGACCAGAAAGAGCCGG -3'
(R):5'- GTGCCATCAATCAGGCCCAG -3'
Posted On2014-10-30