Incidental Mutation 'R2352:Lmtk2'
ID246192
Institutional Source Beutler Lab
Gene Symbol Lmtk2
Ensembl Gene ENSMUSG00000038970
Gene Namelemur tyrosine kinase 2
SynonymsAATYK2, A330101P12Rik, KPI2, cprk, KPI-2, 2900041G10Rik, BREK
MMRRC Submission 040334-MU
Accession Numbers

Genbank: NM_001081109; MGI: 3036247

Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R2352 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location144100436-144188204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144173911 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 483 (D483G)
Ref Sequence ENSEMBL: ENSMUSP00000048238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041804]
Predicted Effect probably benign
Transcript: ENSMUST00000041804
AA Change: D483G

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000048238
Gene: ENSMUSG00000038970
AA Change: D483G

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 42 61 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
STYKc 136 406 3.4e-39 SMART
low complexity region 924 953 N/A INTRINSIC
low complexity region 1019 1035 N/A INTRINSIC
low complexity region 1104 1117 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1354 1367 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation in this gene display partial prenatal lethality, male infertility, and azoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(31) : Targeted, knock-out(1) Gene trapped(30)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,612,108 Q72* probably null Het
2210407C18Rik A T 11: 58,612,850 L10H probably damaging Het
Ankrd28 C T 14: 31,710,947 V548I probably benign Het
Aspm T C 1: 139,457,562 S315P probably benign Het
Caln1 G T 5: 130,506,152 E70* probably null Het
Cd69 A T 6: 129,269,604 W114R probably damaging Het
Cnbd2 T C 2: 156,335,355 Y90H probably damaging Het
Crebrf C T 17: 26,742,346 S147F probably damaging Het
Cts7 A T 13: 61,352,772 C320* probably null Het
Dgat1 T C 15: 76,502,313 I474V possibly damaging Het
Dmxl2 T A 9: 54,393,862 I2322F probably damaging Het
Dnah11 A T 12: 117,928,330 F3703I probably damaging Het
Foxb2 A G 19: 16,873,069 L191P unknown Het
Gli3 A T 13: 15,662,392 E453D probably benign Het
Gnl3 C T 14: 31,016,826 probably null Het
Golgb1 A T 16: 36,898,559 T276S probably damaging Het
Grk4 T C 5: 34,669,176 M40T probably benign Het
Hoxb1 A G 11: 96,366,377 N184S possibly damaging Het
Insr G T 8: 3,192,593 T42N probably damaging Het
Iqgap3 A G 3: 88,104,508 K836E possibly damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Leng9 T A 7: 4,149,410 E89V probably damaging Het
Lhcgr C T 17: 88,742,299 V600I possibly damaging Het
Lima1 T C 15: 99,794,515 N183S probably benign Het
Lpcat2b T G 5: 107,433,441 L212R probably damaging Het
Lrrc61 A T 6: 48,568,872 I210F probably benign Het
Med12l C T 3: 59,240,692 L977F probably damaging Het
Mical1 A T 10: 41,482,233 D414V probably benign Het
Mmp14 C T 14: 54,440,545 A541V probably benign Het
Mtmr10 A G 7: 64,297,580 D81G possibly damaging Het
Myh1 G A 11: 67,220,537 V1601M probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Neb T C 2: 52,287,336 Y1331C probably damaging Het
Otop2 T C 11: 115,329,101 S256P probably damaging Het
Prl8a1 A G 13: 27,575,589 L155P probably damaging Het
Rrp1b A T 17: 32,059,328 M658L possibly damaging Het
Sema4b C A 7: 80,220,879 A525D probably damaging Het
Slc13a5 T A 11: 72,252,321 I369F probably benign Het
Slc22a18 T C 7: 143,497,415 S344P probably benign Het
Slc25a4 A C 8: 46,209,175 S149A probably benign Het
Smc2 A T 4: 52,460,266 E547D probably benign Het
Stx8 A G 11: 67,973,251 T46A probably benign Het
Tacr3 T C 3: 134,854,870 V190A probably benign Het
Tdrkh A T 3: 94,429,160 K468M possibly damaging Het
Tmem145 T C 7: 25,306,173 S4P probably benign Het
Tmem74 A G 15: 43,867,110 I179T probably damaging Het
Vmn1r222 A C 13: 23,232,513 W177G probably benign Het
Zfp426 T C 9: 20,470,105 I529V probably benign Het
Zfp462 A G 4: 55,008,313 Y93C probably null Het
Zfyve26 G A 12: 79,284,116 T443I probably damaging Het
Zkscan16 A C 4: 58,951,869 R181S possibly damaging Het
Other mutations in Lmtk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmtk2 APN 5 144134155 missense probably damaging 1.00
IGL00496:Lmtk2 APN 5 144174694 missense probably benign
IGL00848:Lmtk2 APN 5 144176398 missense probably benign
IGL01450:Lmtk2 APN 5 144174702 missense probably benign 0.03
IGL01833:Lmtk2 APN 5 144175935 nonsense probably null
IGL01967:Lmtk2 APN 5 144182779 missense probably benign
IGL01998:Lmtk2 APN 5 144176065 missense probably damaging 1.00
IGL02106:Lmtk2 APN 5 144175951 missense probably benign 0.03
IGL02147:Lmtk2 APN 5 144156936 missense possibly damaging 0.78
IGL02581:Lmtk2 APN 5 144148348 missense probably damaging 1.00
madagascar UTSW 5 144174919 missense probably benign 0.02
A4554:Lmtk2 UTSW 5 144166317 missense possibly damaging 0.82
R0039:Lmtk2 UTSW 5 144166387 missense probably damaging 1.00
R0039:Lmtk2 UTSW 5 144166387 missense probably damaging 1.00
R0108:Lmtk2 UTSW 5 144174285 missense possibly damaging 0.78
R0367:Lmtk2 UTSW 5 144174285 missense possibly damaging 0.78
R0515:Lmtk2 UTSW 5 144174991 missense possibly damaging 0.77
R1434:Lmtk2 UTSW 5 144174589 missense probably damaging 1.00
R1617:Lmtk2 UTSW 5 144173862 missense probably damaging 1.00
R1760:Lmtk2 UTSW 5 144174175 missense probably damaging 0.99
R1785:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R1786:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R1907:Lmtk2 UTSW 5 144175110 missense probably benign 0.00
R2130:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2131:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2132:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2133:Lmtk2 UTSW 5 144174988 missense possibly damaging 0.61
R2140:Lmtk2 UTSW 5 144147615 missense probably damaging 1.00
R2141:Lmtk2 UTSW 5 144147615 missense probably damaging 1.00
R2210:Lmtk2 UTSW 5 144147609 missense probably damaging 1.00
R2289:Lmtk2 UTSW 5 144176106 missense possibly damaging 0.80
R2312:Lmtk2 UTSW 5 144173626 missense probably damaging 1.00
R3870:Lmtk2 UTSW 5 144166427 splice site probably benign
R4011:Lmtk2 UTSW 5 144175879 missense probably benign 0.01
R4272:Lmtk2 UTSW 5 144183226 missense probably benign 0.05
R4361:Lmtk2 UTSW 5 144147664 missense probably damaging 1.00
R4580:Lmtk2 UTSW 5 144174781 missense possibly damaging 0.56
R4621:Lmtk2 UTSW 5 144174934 missense probably benign 0.02
R4981:Lmtk2 UTSW 5 144176447 missense probably damaging 1.00
R5818:Lmtk2 UTSW 5 144156900 missense probably benign 0.07
R5984:Lmtk2 UTSW 5 144174838 missense probably benign
R6083:Lmtk2 UTSW 5 144182756 missense probably damaging 1.00
R6180:Lmtk2 UTSW 5 144175342 missense probably damaging 1.00
R6411:Lmtk2 UTSW 5 144174586 missense probably damaging 0.99
R6544:Lmtk2 UTSW 5 144173806 missense possibly damaging 0.68
R6628:Lmtk2 UTSW 5 144174685 missense probably benign 0.03
R6698:Lmtk2 UTSW 5 144174919 missense probably benign 0.02
R6742:Lmtk2 UTSW 5 144148357 missense probably damaging 1.00
R6763:Lmtk2 UTSW 5 144173797 missense probably damaging 1.00
R7286:Lmtk2 UTSW 5 144174360 nonsense probably null
R7390:Lmtk2 UTSW 5 144129443 missense possibly damaging 0.79
R7594:Lmtk2 UTSW 5 144173746 missense probably damaging 1.00
R7660:Lmtk2 UTSW 5 144148340 missense probably damaging 1.00
R7785:Lmtk2 UTSW 5 144174753 missense probably benign 0.00
X0024:Lmtk2 UTSW 5 144174250 missense probably benign 0.22
Z1088:Lmtk2 UTSW 5 144182851 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACTCGGAGGTCGACTTTGAAC -3'
(R):5'- GTCACTTCCAACAGAGAGGTTG -3'

Sequencing Primer
(F):5'- TCGACTTTGAACAGCAGTGGAC -3'
(R):5'- AGGTTGTGTGCATCAAACAC -3'
Posted On2014-10-30