Incidental Mutation 'R2352:Slc13a5'
ID246215
Institutional Source Beutler Lab
Gene Symbol Slc13a5
Ensembl Gene ENSMUSG00000020805
Gene Namesolute carrier family 13 (sodium-dependent citrate transporter), member 5
SynonymsIndy, Nact, mINDY, NaC2/NaCT
MMRRC Submission 040334-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2352 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72241989-72267222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72252321 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 369 (I369F)
Ref Sequence ENSEMBL: ENSMUSP00000119417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021161] [ENSMUST00000137701] [ENSMUST00000208056] [ENSMUST00000208912]
Predicted Effect probably benign
Transcript: ENSMUST00000021161
AA Change: I369F

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000021161
Gene: ENSMUSG00000020805
AA Change: I369F

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 8 558 1.3e-121 PFAM
Pfam:CitMHS 13 172 1.6e-14 PFAM
Pfam:CitMHS 202 498 6.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137701
AA Change: I369F

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119417
Gene: ENSMUSG00000020805
AA Change: I369F

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 7 115 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208056
AA Change: I352F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000208912
AA Change: I326F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the solute carrier family 13 group of proteins. This family member is a sodium-dependent citrate cotransporter that may regulate metabolic processes. Mutations in this gene cause early infantile epileptic encephalopathy 25. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a null allele display resistance to diet and age induced obesity, increased energy expenditure, improved glucose tolerance, and increased hepatic lipid oxidation. Mice homozygous for an ENU-induced allele exhibit reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,612,108 Q72* probably null Het
2210407C18Rik A T 11: 58,612,850 L10H probably damaging Het
Ankrd28 C T 14: 31,710,947 V548I probably benign Het
Aspm T C 1: 139,457,562 S315P probably benign Het
Caln1 G T 5: 130,506,152 E70* probably null Het
Cd69 A T 6: 129,269,604 W114R probably damaging Het
Cnbd2 T C 2: 156,335,355 Y90H probably damaging Het
Crebrf C T 17: 26,742,346 S147F probably damaging Het
Cts7 A T 13: 61,352,772 C320* probably null Het
Dgat1 T C 15: 76,502,313 I474V possibly damaging Het
Dmxl2 T A 9: 54,393,862 I2322F probably damaging Het
Dnah11 A T 12: 117,928,330 F3703I probably damaging Het
Foxb2 A G 19: 16,873,069 L191P unknown Het
Gli3 A T 13: 15,662,392 E453D probably benign Het
Gnl3 C T 14: 31,016,826 probably null Het
Golgb1 A T 16: 36,898,559 T276S probably damaging Het
Grk4 T C 5: 34,669,176 M40T probably benign Het
Hoxb1 A G 11: 96,366,377 N184S possibly damaging Het
Insr G T 8: 3,192,593 T42N probably damaging Het
Iqgap3 A G 3: 88,104,508 K836E possibly damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Leng9 T A 7: 4,149,410 E89V probably damaging Het
Lhcgr C T 17: 88,742,299 V600I possibly damaging Het
Lima1 T C 15: 99,794,515 N183S probably benign Het
Lmtk2 A G 5: 144,173,911 D483G probably benign Het
Lpcat2b T G 5: 107,433,441 L212R probably damaging Het
Lrrc61 A T 6: 48,568,872 I210F probably benign Het
Med12l C T 3: 59,240,692 L977F probably damaging Het
Mical1 A T 10: 41,482,233 D414V probably benign Het
Mmp14 C T 14: 54,440,545 A541V probably benign Het
Mtmr10 A G 7: 64,297,580 D81G possibly damaging Het
Myh1 G A 11: 67,220,537 V1601M probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Neb T C 2: 52,287,336 Y1331C probably damaging Het
Otop2 T C 11: 115,329,101 S256P probably damaging Het
Prl8a1 A G 13: 27,575,589 L155P probably damaging Het
Rrp1b A T 17: 32,059,328 M658L possibly damaging Het
Sema4b C A 7: 80,220,879 A525D probably damaging Het
Slc22a18 T C 7: 143,497,415 S344P probably benign Het
Slc25a4 A C 8: 46,209,175 S149A probably benign Het
Smc2 A T 4: 52,460,266 E547D probably benign Het
Stx8 A G 11: 67,973,251 T46A probably benign Het
Tacr3 T C 3: 134,854,870 V190A probably benign Het
Tdrkh A T 3: 94,429,160 K468M possibly damaging Het
Tmem145 T C 7: 25,306,173 S4P probably benign Het
Tmem74 A G 15: 43,867,110 I179T probably damaging Het
Vmn1r222 A C 13: 23,232,513 W177G probably benign Het
Zfp426 T C 9: 20,470,105 I529V probably benign Het
Zfp462 A G 4: 55,008,313 Y93C probably null Het
Zfyve26 G A 12: 79,284,116 T443I probably damaging Het
Zkscan16 A C 4: 58,951,869 R181S possibly damaging Het
Other mutations in Slc13a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Slc13a5 APN 11 72258954 splice site probably null
IGL03392:Slc13a5 APN 11 72245178 missense probably damaging 1.00
Punk UTSW 11 72262076 missense probably damaging 1.00
punk2 UTSW 11 72253391 missense possibly damaging 0.65
R0018:Slc13a5 UTSW 11 72266475 missense probably benign
R0018:Slc13a5 UTSW 11 72266475 missense probably benign
R0042:Slc13a5 UTSW 11 72259114 missense probably benign 0.31
R0194:Slc13a5 UTSW 11 72245233 missense probably benign 0.22
R0194:Slc13a5 UTSW 11 72262130 missense possibly damaging 0.95
R0234:Slc13a5 UTSW 11 72250800 missense probably damaging 0.98
R1499:Slc13a5 UTSW 11 72250731 missense probably damaging 0.97
R1655:Slc13a5 UTSW 11 72257378 missense probably benign 0.00
R1728:Slc13a5 UTSW 11 72266459 splice site probably null
R1818:Slc13a5 UTSW 11 72253343 missense probably benign 0.02
R2304:Slc13a5 UTSW 11 72259039 missense probably damaging 1.00
R2408:Slc13a5 UTSW 11 72262076 missense probably damaging 1.00
R2919:Slc13a5 UTSW 11 72247791 missense possibly damaging 0.92
R2920:Slc13a5 UTSW 11 72247791 missense possibly damaging 0.92
R3103:Slc13a5 UTSW 11 72257388 missense probably damaging 1.00
R4772:Slc13a5 UTSW 11 72250846 critical splice acceptor site probably null
R4906:Slc13a5 UTSW 11 72257418 missense probably damaging 0.99
R5385:Slc13a5 UTSW 11 72259077 missense probably benign 0.01
R5562:Slc13a5 UTSW 11 72262039 missense probably damaging 0.99
R5878:Slc13a5 UTSW 11 72253391 missense possibly damaging 0.65
R6173:Slc13a5 UTSW 11 72253197 missense probably benign 0.05
R6665:Slc13a5 UTSW 11 72260360 missense probably damaging 0.99
R7317:Slc13a5 UTSW 11 72245127 missense probably damaging 1.00
R7338:Slc13a5 UTSW 11 72266484 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTAGGCTTTGTAATGTGGTC -3'
(R):5'- TGGAGGCCAAGAGTTTTAGG -3'

Sequencing Primer
(F):5'- CAGTCCTGTTCAGTGGGAC -3'
(R):5'- GACTCAGCCTACCAGCCTTTAGG -3'
Posted On2014-10-30