Incidental Mutation 'R2353:Hspa14'
ID246242
Institutional Source Beutler Lab
Gene Symbol Hspa14
Ensembl Gene ENSMUSG00000109865
Gene Nameheat shock protein 14
SynonymsHsp70-4, 70kDa, NST-1, HSP70L1
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location3488850-3512814 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 3511176 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027961] [ENSMUST00000027961] [ENSMUST00000036350] [ENSMUST00000124331] [ENSMUST00000124331] [ENSMUST00000140494] [ENSMUST00000140494]
Predicted Effect probably null
Transcript: ENSMUST00000027961
AA Change: Q46*
SMART Domains Protein: ENSMUSP00000027961
Gene: ENSMUSG00000109865
AA Change: Q46*

DomainStartEndE-ValueType
Pfam:HSP70 3 509 6.3e-115 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000027961
AA Change: Q46*
SMART Domains Protein: ENSMUSP00000027961
Gene: ENSMUSG00000109865
AA Change: Q46*

DomainStartEndE-ValueType
Pfam:HSP70 3 509 6.3e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036350
SMART Domains Protein: ENSMUSP00000046297
Gene: ENSMUSG00000039496

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Armet 36 181 2.6e-70 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124331
SMART Domains Protein: ENSMUSP00000119850
Gene: ENSMUSG00000051396

DomainStartEndE-ValueType
Pfam:HSP70 3 74 1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124331
SMART Domains Protein: ENSMUSP00000119850
Gene: ENSMUSG00000051396

DomainStartEndE-ValueType
Pfam:HSP70 3 74 1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132566
Predicted Effect probably null
Transcript: ENSMUST00000140494
SMART Domains Protein: ENSMUSP00000120385
Gene: ENSMUSG00000051396

DomainStartEndE-ValueType
Pfam:HSP70 3 88 1.1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140494
SMART Domains Protein: ENSMUSP00000120385
Gene: ENSMUSG00000051396

DomainStartEndE-ValueType
Pfam:HSP70 3 88 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148167
Meta Mutation Damage Score 0.4766 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Hspa14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Hspa14 APN 2 3502759 missense probably damaging 1.00
IGL02293:Hspa14 APN 2 3511034 missense probably damaging 1.00
IGL02477:Hspa14 APN 2 3496624 missense probably damaging 0.98
IGL02711:Hspa14 APN 2 3502520 missense probably benign 0.15
R0522:Hspa14 UTSW 2 3511049 missense probably damaging 1.00
R1169:Hspa14 UTSW 2 3498124 missense possibly damaging 0.90
R1426:Hspa14 UTSW 2 3508821 missense probably damaging 1.00
R1471:Hspa14 UTSW 2 3491608 missense probably benign 0.01
R1846:Hspa14 UTSW 2 3491660 missense possibly damaging 0.50
R1971:Hspa14 UTSW 2 3489767 missense possibly damaging 0.51
R3508:Hspa14 UTSW 2 3491008 missense probably damaging 1.00
R3859:Hspa14 UTSW 2 3494579 nonsense probably null
R4012:Hspa14 UTSW 2 3512638 missense probably damaging 0.99
R4360:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R4938:Hspa14 UTSW 2 3491609 missense probably benign 0.01
R5028:Hspa14 UTSW 2 3498169 missense possibly damaging 0.72
R5326:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R5542:Hspa14 UTSW 2 3502523 missense possibly damaging 0.89
R5881:Hspa14 UTSW 2 3498170 missense probably benign 0.34
R6046:Hspa14 UTSW 2 3489764 missense possibly damaging 0.91
R6076:Hspa14 UTSW 2 3511072 missense probably benign 0.00
R6112:Hspa14 UTSW 2 3498068 missense probably benign
R6334:Hspa14 UTSW 2 3489072 unclassified probably null
R7297:Hspa14 UTSW 2 3498142 missense possibly damaging 0.76
R7424:Hspa14 UTSW 2 3489041 missense possibly damaging 0.95
R7510:Hspa14 UTSW 2 3498122 missense probably benign 0.01
R7692:Hspa14 UTSW 2 3496606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGCCATACCTTCTGCCAAG -3'
(R):5'- GACTTTAAGGCCTGAATGGGTG -3'

Sequencing Primer
(F):5'- AAGGATCTGTTTCACTTTCACTACTG -3'
(R):5'- AAGGCCTGAATGGGTGTCACTC -3'
Posted On2014-10-30