Incidental Mutation 'R2353:Garnl3'
ID246243
Institutional Source Beutler Lab
Gene Symbol Garnl3
Ensembl Gene ENSMUSG00000038860
Gene NameGTPase activating RANGAP domain-like 3
Synonyms
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32986224-33131654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33064034 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 86 (R86S)
Ref Sequence ENSEMBL: ENSMUSP00000122576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000124000] [ENSMUST00000127509] [ENSMUST00000133135] [ENSMUST00000137381]
Predicted Effect probably damaging
Transcript: ENSMUST00000049618
AA Change: R45S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: R45S

DomainStartEndE-ValueType
Pfam:Rap_GAP 202 383 3.4e-73 PFAM
Pfam:CNH 475 780 3.5e-67 PFAM
low complexity region 793 804 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102810
AA Change: R41S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: R41S

DomainStartEndE-ValueType
Pfam:Rap_GAP 198 385 4.6e-67 PFAM
Pfam:CNH 471 776 1.8e-68 PFAM
low complexity region 789 800 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124000
AA Change: R126S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123601
Gene: ENSMUSG00000038860
AA Change: R126S

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127509
Predicted Effect probably damaging
Transcript: ENSMUST00000133135
AA Change: R86S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135296
Predicted Effect probably damaging
Transcript: ENSMUST00000137381
AA Change: R86S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148043
Meta Mutation Damage Score 0.5965 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Garnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Garnl3 APN 2 33006816 missense probably damaging 1.00
IGL01601:Garnl3 APN 2 32997689 nonsense probably null
IGL01981:Garnl3 APN 2 32997729 missense probably damaging 0.98
IGL02209:Garnl3 APN 2 33085930 missense probably damaging 0.99
IGL02434:Garnl3 APN 2 33054205 missense probably damaging 1.00
IGL02512:Garnl3 APN 2 33031138 missense probably damaging 1.00
IGL02947:Garnl3 APN 2 33046594 missense probably damaging 1.00
PIT4403001:Garnl3 UTSW 2 32990758 missense probably damaging 1.00
R0123:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0134:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0225:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0551:Garnl3 UTSW 2 33016738 missense probably damaging 1.00
R0691:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0693:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0737:Garnl3 UTSW 2 32990642 missense probably damaging 0.98
R1350:Garnl3 UTSW 2 33052214 missense probably damaging 1.00
R1691:Garnl3 UTSW 2 32997663 nonsense probably null
R1791:Garnl3 UTSW 2 33034127 missense probably benign 0.02
R1938:Garnl3 UTSW 2 33005200 missense probably damaging 0.99
R2100:Garnl3 UTSW 2 33046645 missense probably benign 0.35
R2316:Garnl3 UTSW 2 33005152 missense probably damaging 1.00
R3161:Garnl3 UTSW 2 33034711 missense probably damaging 1.00
R3839:Garnl3 UTSW 2 32989546 missense probably benign 0.00
R3847:Garnl3 UTSW 2 32992228 missense probably benign
R4871:Garnl3 UTSW 2 33087088 start codon destroyed probably null 0.77
R5682:Garnl3 UTSW 2 33054173 missense probably damaging 1.00
R5811:Garnl3 UTSW 2 33006899 missense probably damaging 0.99
R6267:Garnl3 UTSW 2 33104880 missense probably benign 0.20
R6502:Garnl3 UTSW 2 33006821 missense possibly damaging 0.67
R6532:Garnl3 UTSW 2 33031119 missense possibly damaging 0.87
R6639:Garnl3 UTSW 2 32989525 missense possibly damaging 0.75
R6763:Garnl3 UTSW 2 33054196 missense probably damaging 1.00
R6866:Garnl3 UTSW 2 33002773 splice site probably null
R6913:Garnl3 UTSW 2 32986829 missense possibly damaging 0.91
R7002:Garnl3 UTSW 2 33054193 missense possibly damaging 0.65
R7168:Garnl3 UTSW 2 32995078 missense probably damaging 1.00
R7341:Garnl3 UTSW 2 33034129 missense probably damaging 1.00
R7746:Garnl3 UTSW 2 32992257 missense probably damaging 1.00
R7919:Garnl3 UTSW 2 33046599 missense probably benign 0.38
R8079:Garnl3 UTSW 2 33018499 critical splice donor site probably null
R8087:Garnl3 UTSW 2 33045536 missense probably benign 0.01
R8123:Garnl3 UTSW 2 33104938 missense probably damaging 0.97
R8170:Garnl3 UTSW 2 33015223 missense possibly damaging 0.88
R8347:Garnl3 UTSW 2 33085891 missense probably damaging 1.00
R8418:Garnl3 UTSW 2 33052146 missense possibly damaging 0.73
R8679:Garnl3 UTSW 2 33026094 missense probably damaging 1.00
X0022:Garnl3 UTSW 2 33022668 missense probably damaging 1.00
X0023:Garnl3 UTSW 2 33026149 missense probably damaging 1.00
X0024:Garnl3 UTSW 2 33005179 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GACCTTCTATGACCCCATAATGG -3'
(R):5'- CTCTTAAGGCCTCAAGGTTCC -3'

Sequencing Primer
(F):5'- ATGACCCCATAATGGTATTTCCC -3'
(R):5'- TTAAGGCCTCAAGGTTCCCAGAG -3'
Posted On2014-10-30