Incidental Mutation 'R2353:Olfr1270'
ID246244
Institutional Source Beutler Lab
Gene Symbol Olfr1270
Ensembl Gene ENSMUSG00000075065
Gene Nameolfactory receptor 1270
SynonymsMOR227-1, GA_x6K02T2Q125-51584440-51583526
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location90145255-90153091 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90149718 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 96 (L96Q)
Ref Sequence ENSEMBL: ENSMUSP00000150561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099754] [ENSMUST00000213946] [ENSMUST00000215578] [ENSMUST00000215975] [ENSMUST00000216354] [ENSMUST00000217139]
Predicted Effect probably damaging
Transcript: ENSMUST00000099754
AA Change: L96Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097343
Gene: ENSMUSG00000075065
AA Change: L96Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.3e-54 PFAM
Pfam:7TM_GPCR_Srsx 33 300 7.5e-6 PFAM
Pfam:7tm_1 39 285 2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165784
SMART Domains Protein: ENSMUSP00000126140
Gene: ENSMUSG00000091703

DomainStartEndE-ValueType
HOX 19 81 1.29e-3 SMART
low complexity region 118 128 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213946
AA Change: L96Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215578
AA Change: L96Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215975
AA Change: L96Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216354
AA Change: L96Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217139
AA Change: L96Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.2150 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Olfr1270
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02648:Olfr1270 APN 2 90149353 missense possibly damaging 0.61
IGL03034:Olfr1270 APN 2 90149833 missense probably damaging 1.00
R0726:Olfr1270 UTSW 2 90149283 missense probably damaging 1.00
R1573:Olfr1270 UTSW 2 90148724 utr 3 prime probably benign
R1965:Olfr1270 UTSW 2 90149404 missense probably damaging 0.98
R1966:Olfr1270 UTSW 2 90149404 missense probably damaging 0.98
R3805:Olfr1270 UTSW 2 90148461 utr 3 prime probably benign
R4606:Olfr1270 UTSW 2 90148816 utr 3 prime probably benign
R4662:Olfr1270 UTSW 2 90149878 missense probably damaging 1.00
R6198:Olfr1270 UTSW 2 90149438 missense probably damaging 1.00
R6596:Olfr1270 UTSW 2 90149278 missense possibly damaging 0.73
R6957:Olfr1270 UTSW 2 90149150 nonsense probably null
R7408:Olfr1270 UTSW 2 90149844 missense probably benign
R7418:Olfr1270 UTSW 2 90149487 missense probably damaging 1.00
R7454:Olfr1270 UTSW 2 90149419 missense possibly damaging 0.78
R7935:Olfr1270 UTSW 2 90149584 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACATTGGGACCACAGAAGG -3'
(R):5'- TGTACCTGGCCACAGTGTTG -3'

Sequencing Primer
(F):5'- TGAATTATAGAATGTAAAAAGCCCCC -3'
(R):5'- CACAGTGTTGGGCAATGGC -3'
Posted On2014-10-30