Incidental Mutation 'R2353:Aadacl4'
ID246246
Institutional Source Beutler Lab
Gene Symbol Aadacl4
Ensembl Gene ENSMUSG00000070609
Gene Namearylacetamide deacetylase like 4
SynonymsGm13177
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location144613707-144623398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 144623209 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 345 (E345D)
Ref Sequence ENSEMBL: ENSMUSP00000092087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094510]
Predicted Effect probably damaging
Transcript: ENSMUST00000094510
AA Change: E345D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092087
Gene: ENSMUSG00000070609
AA Change: E345D

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
transmembrane domain 43 60 N/A INTRINSIC
Pfam:Abhydrolase_3 115 285 9.6e-30 PFAM
Pfam:Abhydrolase_3 272 381 4.9e-11 PFAM
Meta Mutation Damage Score 0.5512 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Aadacl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02648:Aadacl4 APN 4 144617822 critical splice acceptor site probably null
IGL02836:Aadacl4 APN 4 144623212 missense possibly damaging 0.79
IGL02949:Aadacl4 APN 4 144617920 missense probably damaging 1.00
IGL03253:Aadacl4 APN 4 144623288 missense probably benign 0.05
white_rabbit UTSW 4 144618028 missense probably benign 0.03
R0035:Aadacl4 UTSW 4 144617941 missense probably damaging 0.98
R0268:Aadacl4 UTSW 4 144622995 missense probably benign 0.00
R1427:Aadacl4 UTSW 4 144623040 missense probably damaging 1.00
R1672:Aadacl4 UTSW 4 144623319 nonsense probably null
R2220:Aadacl4 UTSW 4 144618002 missense probably damaging 0.98
R2983:Aadacl4 UTSW 4 144623214 missense probably damaging 0.98
R4708:Aadacl4 UTSW 4 144623329 missense probably benign 0.01
R4878:Aadacl4 UTSW 4 144613845 missense possibly damaging 0.62
R4911:Aadacl4 UTSW 4 144613792 missense probably damaging 1.00
R5208:Aadacl4 UTSW 4 144617828 missense probably benign 0.04
R5237:Aadacl4 UTSW 4 144623280 nonsense probably null
R5568:Aadacl4 UTSW 4 144622794 missense probably benign 0.03
R5633:Aadacl4 UTSW 4 144618028 missense probably benign 0.03
R5817:Aadacl4 UTSW 4 144622927 missense probably benign 0.04
R5848:Aadacl4 UTSW 4 144617858 missense probably benign 0.11
R5916:Aadacl4 UTSW 4 144622980 missense possibly damaging 0.93
R6736:Aadacl4 UTSW 4 144623339 missense possibly damaging 0.82
R6814:Aadacl4 UTSW 4 144623180 missense probably benign 0.07
R6872:Aadacl4 UTSW 4 144623180 missense probably benign 0.07
R6971:Aadacl4 UTSW 4 144622733 missense probably damaging 1.00
R6994:Aadacl4 UTSW 4 144623279 missense probably damaging 1.00
R7074:Aadacl4 UTSW 4 144613863 missense probably benign
R7353:Aadacl4 UTSW 4 144617920 missense probably damaging 1.00
R7837:Aadacl4 UTSW 4 144617977 missense probably damaging 1.00
R7853:Aadacl4 UTSW 4 144618022 missense probably benign 0.02
R8120:Aadacl4 UTSW 4 144622890 missense probably benign 0.44
R8549:Aadacl4 UTSW 4 144623156 missense probably benign
X0017:Aadacl4 UTSW 4 144623016 missense probably damaging 1.00
X0065:Aadacl4 UTSW 4 144623109 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGTATAGAAAATGGCTCAGCTC -3'
(R):5'- CAAAGGTGACTGTCATATGCCC -3'

Sequencing Primer
(F):5'- GGCTCAGCTCTGATAACATTCCTAG -3'
(R):5'- ATGCCCTTTATGTAACTGGCAAC -3'
Posted On2014-10-30