Incidental Mutation 'R2353:Uts2'
ID246247
Institutional Source Beutler Lab
Gene Symbol Uts2
Ensembl Gene ENSMUSG00000028963
Gene Nameurotensin 2
SynonymsUcn2, urotensin II precursor, prepro-UII
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location150997097-151001810 bp(+) (GRCm38)
Type of Mutationsplice site (62540 bp from exon)
DNA Base Change (assembly) T to A at 151000136 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030803] [ENSMUST00000103204] [ENSMUST00000169423]
Predicted Effect probably benign
Transcript: ENSMUST00000030803
SMART Domains Protein: ENSMUSP00000030803
Gene: ENSMUSG00000028963

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 36 53 N/A INTRINSIC
Pfam:Urotensin_II 112 123 3.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103204
SMART Domains Protein: ENSMUSP00000099493
Gene: ENSMUSG00000028957

DomainStartEndE-ValueType
PAS 115 187 2.86e1 SMART
PAS 258 324 1.31e-5 SMART
PAC 333 376 1.52e-1 SMART
low complexity region 414 427 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Pfam:Period_C 905 1111 4.4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138052
Predicted Effect probably null
Transcript: ENSMUST00000169423
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes a member of the urotensin family of peptide hormones. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional hormone before secretion into the plasma. Mice lacking the encoded protein have a significantly decreased low density lipoprotein cholesterol profile and hepatic steatosis that is consistent with decreased hepatocyte de novo cholesterol synthesis and apolipoprotein B secretion. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to alterations in macrophage and hepatic cholesterol homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Uts2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5296:Uts2 UTSW 4 150999051 missense possibly damaging 0.70
R5689:Uts2 UTSW 4 150999108 missense possibly damaging 0.53
R5946:Uts2 UTSW 4 150999049 missense probably benign 0.02
R8199:Uts2 UTSW 4 151001658 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GGATCCCAGATTCTGTATGTTTTGC -3'
(R):5'- TACCCAGAGTAGGCATCTGTTAC -3'

Sequencing Primer
(F):5'- CAATAAGCATAACTGGCGGGTGTG -3'
(R):5'- CAGAGTAGGCATCTGTTACATTCTTG -3'
Posted On2014-10-30