Incidental Mutation 'R2353:Cd38'
ID246249
Institutional Source Beutler Lab
Gene Symbol Cd38
Ensembl Gene ENSMUSG00000029084
Gene NameCD38 antigen
SynonymsCd38-rs1
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location43868553-43912375 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 43908011 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030964]
PDB Structure Crystal structure of the truncated extracellular domain of mouse CD38 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000030964
SMART Domains Protein: ENSMUSP00000030964
Gene: ENSMUSG00000029084

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Rib_hydrolayse 59 300 2.9e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154897
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Knockout mice deficient for this gene display altered humoral immune responses. In addition, knockout mice exhibit higher locomotor activity and defects in nurturing and social behaviors. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene has resulted in an impaired antibody response to T cell dependent antigens and disrupted glucose-dependent insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Cd38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Cd38 APN 5 43903597 missense probably benign 0.04
IGL01691:Cd38 APN 5 43903586 splice site probably benign
IGL02585:Cd38 APN 5 43910302 missense probably damaging 1.00
paradiso UTSW 5 43903585 splice site probably null
IGL02796:Cd38 UTSW 5 43906213 missense probably damaging 1.00
R0496:Cd38 UTSW 5 43868891 missense probably damaging 1.00
R0855:Cd38 UTSW 5 43903585 splice site probably null
R1621:Cd38 UTSW 5 43901524 missense probably benign 0.00
R2366:Cd38 UTSW 5 43903590 splice site probably benign
R2860:Cd38 UTSW 5 43901433 missense probably damaging 1.00
R2861:Cd38 UTSW 5 43901433 missense probably damaging 1.00
R4342:Cd38 UTSW 5 43869089 missense probably benign 0.00
R4343:Cd38 UTSW 5 43869089 missense probably benign 0.00
R4344:Cd38 UTSW 5 43869089 missense probably benign 0.00
R4953:Cd38 UTSW 5 43907545 missense possibly damaging 0.73
R5007:Cd38 UTSW 5 43906164 missense probably damaging 1.00
R5371:Cd38 UTSW 5 43868883 missense probably benign 0.01
R5699:Cd38 UTSW 5 43900386 missense probably damaging 1.00
R6857:Cd38 UTSW 5 43906198 missense probably damaging 0.99
R6945:Cd38 UTSW 5 43908006 missense probably damaging 1.00
R7129:Cd38 UTSW 5 43910309 missense probably benign 0.13
R7825:Cd38 UTSW 5 43901455 missense probably damaging 1.00
R7852:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7855:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R7894:Cd38 UTSW 5 43900404 missense probably damaging 1.00
R8133:Cd38 UTSW 5 43901448 missense probably damaging 1.00
R8134:Cd38 UTSW 5 43901448 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCTTTGCTCCTGGTGAC -3'
(R):5'- AAGTCAAGACATCACTTAGGGCTG -3'

Sequencing Primer
(F):5'- TGGTGACCAGAGAAGCCC -3'
(R):5'- ACATCACTTAGGGCTGGCAGG -3'
Posted On2014-10-30