Incidental Mutation 'R2353:Msi1'
ID246250
Institutional Source Beutler Lab
Gene Symbol Msi1
Ensembl Gene ENSMUSG00000054256
Gene Namemusashi RNA-binding protein 1
Synonymsm-Msi-1, Msi1h, Msi1, Musahi1
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R2353 (G1)
Quality Score169
Status Validated
Chromosome5
Chromosomal Location115429599-115455698 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 115436509 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136586] [ENSMUST00000150779]
PDB Structure Solution structure of the N-terminal RNA-binding domain of mouse Musashi1 [SOLUTION NMR]
MUSASHI1 RBD2, NMR [SOLUTION NMR]
MUSASHI1 RBD2, NMR [SOLUTION NMR]
1H, 13C, and 15N Chemical Shift Assignments for Musashi1 RBD1:r(GUAGU) complex [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000067168
SMART Domains Protein: ENSMUSP00000070415
Gene: ENSMUSG00000054256

DomainStartEndE-ValueType
RRM 2 67 7.47e-14 SMART
RRM 84 156 4e-23 SMART
low complexity region 258 269 N/A INTRINSIC
low complexity region 297 304 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000078701
AA Change: A11S
SMART Domains Protein: ENSMUSP00000077767
Gene: ENSMUSG00000057354
AA Change: A11S

DomainStartEndE-ValueType
low complexity region 96 111 N/A INTRINSIC
low complexity region 118 150 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130849
Predicted Effect probably benign
Transcript: ENSMUST00000131079
Predicted Effect probably benign
Transcript: ENSMUST00000136586
SMART Domains Protein: ENSMUSP00000143900
Gene: ENSMUSG00000054256

DomainStartEndE-ValueType
RRM 7 79 1.7e-25 SMART
transmembrane domain 102 124 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145840
Predicted Effect probably benign
Transcript: ENSMUST00000150779
SMART Domains Protein: ENSMUSP00000120516
Gene: ENSMUSG00000054256

DomainStartEndE-ValueType
RRM 21 93 2e-23 SMART
RRM 110 182 4e-23 SMART
low complexity region 295 306 N/A INTRINSIC
low complexity region 334 341 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202548
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing two conserved tandem RNA recognition motifs. Similar proteins in other species function as RNA-binding proteins and play central roles in posttranscriptional gene regulation. Expression of this gene has been correlated with the grade of the malignancy and proliferative activity in gliomas and melanomas. A pseudogene for this gene is located on chromosome 11q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygous null mice develop hydrocephalus associated with progressive ventricular dilation, a large domed cranium, thin cerebral cortices, callosal agenesis, aberrant proliferation and polyposis of ependymal cells, intracerebral bleeding, ataxia, dehydration and death at 1-2 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Msi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Msi1 APN 5 115435521 missense possibly damaging 0.95
IGL01390:Msi1 APN 5 115438721 missense possibly damaging 0.72
IGL01585:Msi1 APN 5 115430890 critical splice donor site probably null
IGL02232:Msi1 APN 5 115441447 critical splice donor site probably null
R0416:Msi1 UTSW 5 115430649 missense possibly damaging 0.56
R0828:Msi1 UTSW 5 115430894 splice site probably null
R2517:Msi1 UTSW 5 115445458 missense probably damaging 1.00
R4646:Msi1 UTSW 5 115451455 critical splice acceptor site probably null
R4663:Msi1 UTSW 5 115450275 missense probably damaging 1.00
R4897:Msi1 UTSW 5 115435595 intron probably benign
R4963:Msi1 UTSW 5 115450885 missense probably damaging 1.00
R5461:Msi1 UTSW 5 115441391 missense possibly damaging 0.89
R6019:Msi1 UTSW 5 115451491 missense probably damaging 1.00
R6210:Msi1 UTSW 5 115435476 missense probably damaging 1.00
R6431:Msi1 UTSW 5 115450925 missense probably damaging 0.98
R6957:Msi1 UTSW 5 115445424 missense probably benign 0.04
R7105:Msi1 UTSW 5 115433870 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATGTGAATTCCCCATCAGG -3'
(R):5'- TCACATGCCAACGCCGATTTAG -3'

Sequencing Primer
(F):5'- GTGAATTCCCCATCAGGCCAAG -3'
(R):5'- TTTAGGCCCGAACAAAAGACG -3'
Posted On2014-10-30