Incidental Mutation 'R2353:Lrrc4'
ID246252
Institutional Source Beutler Lab
Gene Symbol Lrrc4
Ensembl Gene ENSMUSG00000049939
Gene Nameleucine rich repeat containing 4
SynonymsNLG-2, Nag14, NGL-2
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location28661831-28831747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28831452 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 55 (F55L)
Ref Sequence ENSEMBL: ENSMUSP00000062158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000062304] [ENSMUST00000164915] [ENSMUST00000167201] [ENSMUST00000171353]
Predicted Effect probably benign
Transcript: ENSMUST00000001460
SMART Domains Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SNc 525 660 3.82e-45 SMART
TUDOR 728 785 4.8e-19 SMART
Pfam:SNase 835 895 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000062304
AA Change: F55L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000062158
Gene: ENSMUSG00000049939
AA Change: F55L

DomainStartEndE-ValueType
low complexity region 32 40 N/A INTRINSIC
LRRNT 44 78 4.05e-5 SMART
LRR 72 96 1.19e2 SMART
LRR_TYP 97 120 2.24e-3 SMART
LRR 121 144 6.13e-1 SMART
LRR_TYP 145 168 5.99e-4 SMART
LRR 216 239 1.25e-1 SMART
LRR 240 263 4.71e1 SMART
LRR_TYP 264 287 2.79e-4 SMART
LRRCT 299 350 8.06e-6 SMART
IGc2 364 430 5.24e-7 SMART
low complexity region 452 462 N/A INTRINSIC
transmembrane domain 527 549 N/A INTRINSIC
low complexity region 575 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164915
SMART Domains Protein: ENSMUSP00000127317
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 142 1.56e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167201
SMART Domains Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SCOP:d1sty__ 526 592 1e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171195
Predicted Effect probably benign
Transcript: ENSMUST00000171353
SMART Domains Protein: ENSMUSP00000129497
Gene: ENSMUSG00000049939

DomainStartEndE-ValueType
low complexity region 29 39 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is significantly downregulated in primary brain tumors. The exact function of the protein encoded by this gene is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity, an absence of startle reflex, and abnormal ABR amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Lrrc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:Lrrc4 APN 6 28830880 missense probably damaging 0.99
IGL03223:Lrrc4 APN 6 28831470 missense probably damaging 1.00
IGL03410:Lrrc4 APN 6 28830516 missense probably damaging 1.00
R0233:Lrrc4 UTSW 6 28829735 missense probably benign 0.05
R0233:Lrrc4 UTSW 6 28829735 missense probably benign 0.05
R0456:Lrrc4 UTSW 6 28831104 missense probably damaging 1.00
R1162:Lrrc4 UTSW 6 28831084 missense probably damaging 1.00
R2001:Lrrc4 UTSW 6 28830905 missense probably damaging 1.00
R2089:Lrrc4 UTSW 6 28830587 missense probably benign 0.45
R2091:Lrrc4 UTSW 6 28830587 missense probably benign 0.45
R2091:Lrrc4 UTSW 6 28830587 missense probably benign 0.45
R5079:Lrrc4 UTSW 6 28830770 missense possibly damaging 0.69
R5197:Lrrc4 UTSW 6 28830143 missense probably damaging 1.00
R6701:Lrrc4 UTSW 6 28830906 missense possibly damaging 0.95
R6755:Lrrc4 UTSW 6 28831293 missense probably damaging 1.00
R7660:Lrrc4 UTSW 6 28829817 missense probably benign 0.00
R7661:Lrrc4 UTSW 6 28829763 missense probably benign 0.00
R8113:Lrrc4 UTSW 6 28829903 missense probably damaging 0.97
R8272:Lrrc4 UTSW 6 28662193 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGCCTGATGGAGTTCCTG -3'
(R):5'- AAGGCTGGTTCTCTTTTCCAAGC -3'

Sequencing Primer
(F):5'- TGATGGAGTTCCTGCCCAG -3'
(R):5'- TGGTGAATTATGAACGTGCCACAC -3'
Posted On2014-10-30