Mutagenetix > Incidental Mutations

Incidental Mutation 'R2353:Cd163'

246253

Institutional Source

Beutler Lab

Gene Symbol

Cd163

Ensembl Gene

ENSMUSG00000008845

Gene Name

CD163 antigen

Synonyms

MMRRC Submission

040335-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2353 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124304656-124330527 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 124319156 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 820 (E820*)

Ref Sequence

ENSEMBL: ENSMUSP00000108160 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]

Predicted Effect

probably null
Transcript: ENSMUST00000032234
AA Change: E820*

SMART Domains

Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: E820*

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
SR	50	150	1.1e-52	SMART
SR	157	258	1.4e-55	SMART
SR	265	365	7.3e-60	SMART
SR	372	472	1.2e-35	SMART
SR	477	577	2.3e-41	SMART
SR	582	682	9.8e-39	SMART
SR	719	819	1.1e-60	SMART
SR	824	927	4e-24	SMART
SR	930	1030	2.3e-55	SMART
transmembrane domain	1046	1068	N/A	INTRINSIC
low complexity region	1095	1107	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000112541
AA Change: E820*

SMART Domains

Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: E820*

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
SR	50	150	2.26e-50	SMART
SR	157	258	3.11e-53	SMART
SR	265	365	1.54e-57	SMART
SR	372	472	2.64e-33	SMART
SR	477	577	5.03e-39	SMART
SR	582	682	2.09e-36	SMART
SR	719	819	2.38e-58	SMART
SR	824	927	8.93e-22	SMART
SR	930	1030	5.06e-53	SMART
transmembrane domain	1046	1068	N/A	INTRINSIC
low complexity region	1095	1107	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203210

Meta Mutation Damage Score

0.9717

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	G	T	4: 144,623,209	E345D	probably damaging	Het
Adam7	T	A	14: 68,505,088	Q692L	probably benign	Het
AF366264	T	A	8: 13,836,951	E380V	probably damaging	Het
Ankk1	A	C	9: 49,418,690	C322G	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
Apeh	T	C	9: 108,086,292	D577G	possibly damaging	Het
Aspm	T	A	1: 139,477,697	W1441R	probably damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Cd38	T	A	5: 43,908,011		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Enpp1	C	A	10: 24,651,341	Q649H	probably benign	Het
Garnl3	T	A	2: 33,064,034	R86S	probably damaging	Het
Gbe1	A	G	16: 70,437,021		probably null	Het
Gm5117	A	G	8: 31,739,195		noncoding transcript	Het
Hip1	A	T	5: 135,412,712	V568E	probably damaging	Het
Hspa14	G	A	2: 3,511,176		probably null	Het
Lrrc4	A	G	6: 28,831,452	F55L	probably benign	Het
Med31	T	A	11: 72,214,140	N35I	probably damaging	Het
Msi1	C	A	5: 115,436,509		probably benign	Het
Olfr1270	A	T	2: 90,149,718	L96Q	probably damaging	Het
Olfr394	T	C	11: 73,887,834	I179M	probably benign	Het
Parl	T	C	16: 20,287,040	T211A	probably benign	Het
Ppwd1	T	C	13: 104,213,582	I432V	probably benign	Het
Scn10a	T	A	9: 119,638,687	I796F	probably damaging	Het
Sh3rf3	A	G	10: 59,007,073	D287G	probably damaging	Het
Sin3b	T	C	8: 72,724,152		probably null	Het
Ubr4	T	C	4: 139,433,673	I2493T	possibly damaging	Het
Uts2	T	A	4: 151,000,136		probably null	Het
Zfp109	T	C	7: 24,229,381	D201G	probably benign	Het
Zfp407	A	G	18: 84,559,880	F1036S	probably damaging	Het
Znrf3	T	C	11: 5,281,170	E685G	probably damaging	Het

Other mutations in Cd163

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Cd163	APN	6	124329101	splice site	probably benign
IGL00755:Cd163	APN	6	124318657	missense	possibly damaging	0.70
IGL01690:Cd163	APN	6	124307318	missense	possibly damaging	0.89
IGL02101:Cd163	APN	6	124307287	nonsense	probably null
IGL02733:Cd163	APN	6	124325341	missense	probably damaging	1.00
IGL02801:Cd163	APN	6	124320529	missense	probably benign	0.00
IGL02897:Cd163	APN	6	124325527	missense	probably damaging	1.00
IGL03074:Cd163	APN	6	124317986	missense	probably benign	0.00
IGL03283:Cd163	APN	6	124309199	missense	possibly damaging	0.49
compass	UTSW	6	124329086	makesense	probably null
hottish	UTSW	6	124309208	missense	probably damaging	1.00
protractor	UTSW	6	124311566	missense	probably damaging	1.00
t-square	UTSW	6	124325288	missense	probably damaging	0.97
R0494:Cd163	UTSW	6	124311449	missense	probably damaging	1.00
R0554:Cd163	UTSW	6	124312660	missense	probably benign	0.03
R0622:Cd163	UTSW	6	124317352	missense	probably damaging	1.00
R1004:Cd163	UTSW	6	124325347	missense	probably damaging	1.00
R1061:Cd163	UTSW	6	124309169	missense	probably benign	0.00
R1132:Cd163	UTSW	6	124309096	nonsense	probably null
R1195:Cd163	UTSW	6	124325250	splice site	probably benign
R1195:Cd163	UTSW	6	124325250	splice site	probably benign
R1436:Cd163	UTSW	6	124327931	missense	possibly damaging	0.47
R1463:Cd163	UTSW	6	124311447	missense	probably damaging	1.00
R1532:Cd163	UTSW	6	124312730	missense	possibly damaging	0.91
R1541:Cd163	UTSW	6	124327961	missense	probably benign
R1654:Cd163	UTSW	6	124317581	missense	probably damaging	1.00
R1717:Cd163	UTSW	6	124329588	utr 3 prime	probably benign
R1744:Cd163	UTSW	6	124307028	missense	possibly damaging	0.94
R2014:Cd163	UTSW	6	124325498	missense	probably damaging	0.99
R2035:Cd163	UTSW	6	124320629	missense	probably damaging	0.97
R2095:Cd163	UTSW	6	124317822	missense	probably damaging	1.00
R2124:Cd163	UTSW	6	124318856	missense	probably damaging	1.00
R2146:Cd163	UTSW	6	124309208	missense	probably damaging	1.00
R3854:Cd163	UTSW	6	124311566	missense	probably damaging	1.00
R4425:Cd163	UTSW	6	124327903	missense	possibly damaging	0.94
R4631:Cd163	UTSW	6	124329086	makesense	probably null
R4647:Cd163	UTSW	6	124320621	missense	probably damaging	1.00
R4713:Cd163	UTSW	6	124317618	critical splice donor site	probably null
R4803:Cd163	UTSW	6	124312430	missense	probably damaging	0.99
R4996:Cd163	UTSW	6	124319147	missense	probably benign	0.00
R5022:Cd163	UTSW	6	124325288	missense	probably damaging	0.97
R5023:Cd163	UTSW	6	124325288	missense	probably damaging	0.97
R5032:Cd163	UTSW	6	124311669	missense	probably damaging	1.00
R5057:Cd163	UTSW	6	124325288	missense	probably damaging	0.97
R5121:Cd163	UTSW	6	124317989	missense	probably damaging	1.00
R5436:Cd163	UTSW	6	124327964	missense	probably benign
R5453:Cd163	UTSW	6	124312541	missense	probably damaging	1.00
R5723:Cd163	UTSW	6	124319063	missense	probably benign	0.00
R5929:Cd163	UTSW	6	124326609	critical splice donor site	probably null
R5943:Cd163	UTSW	6	124329602	makesense	probably null
R5964:Cd163	UTSW	6	124326572	missense	probably benign	0.01
R5966:Cd163	UTSW	6	124320636	nonsense	probably null
R6279:Cd163	UTSW	6	124317991	nonsense	probably null
R6300:Cd163	UTSW	6	124317991	nonsense	probably null
R6499:Cd163	UTSW	6	124304744	missense	probably benign	0.00
R6602:Cd163	UTSW	6	124311635	missense	probably damaging	1.00
R6708:Cd163	UTSW	6	124309208	missense	probably damaging	1.00
R6767:Cd163	UTSW	6	124304779	missense	possibly damaging	0.56
R6979:Cd163	UTSW	6	124317986	missense	probably benign	0.00
R6993:Cd163	UTSW	6	124317714	missense	probably damaging	1.00
R7345:Cd163	UTSW	6	124318938	missense	possibly damaging	0.52
R7382:Cd163	UTSW	6	124311312	splice site	probably null
R7552:Cd163	UTSW	6	124307228	missense	probably benign	0.08
R7829:Cd163	UTSW	6	124304779	missense	probably benign	0.04
R8354:Cd163	UTSW	6	124328965	missense	probably benign	0.43
R8454:Cd163	UTSW	6	124328965	missense	probably benign	0.43
R8530:Cd163	UTSW	6	124318901	missense	probably damaging	1.00
R8560:Cd163	UTSW	6	124317401	missense	possibly damaging	0.86
Z1177:Cd163	UTSW	6	124317385	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- CCGTCTGTGATGACAATTGGG -3'
(R):5'- GTACAAGCAAACACATGAGATTGTACC -3'

Sequencing Primer
(F):5'- CAATTGGGATATGACTGATGCC -3'
(R):5'- CACATGAGATTGTACCAACACGTTG -3'

Posted On

2014-10-30