Mutagenetix > Incidental Mutation

Incidental Mutation 'R2353:Cd163'

246253

Institutional Source

Beutler Lab

Gene Symbol

Cd163

Ensembl Gene

ENSMUSG00000008845

Gene Name

CD163 antigen

Synonyms

MMRRC Submission

040335-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2353 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124281615-124307486 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 124296115 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 820 (E820*)

Ref Sequence

ENSEMBL: ENSMUSP00000108160 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]

AlphaFold

Q2VLH6

Predicted Effect

probably null
Transcript: ENSMUST00000032234
AA Change: E820*

SMART Domains

Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: E820*

Domain	Start	End	E-Value	Type
transmembrane domain	20	42	N/A	INTRINSIC
SR	50	150	1.1e-52	SMART
SR	157	258	1.4e-55	SMART
SR	265	365	7.3e-60	SMART
SR	372	472	1.2e-35	SMART
SR	477	577	2.3e-41	SMART
SR	582	682	9.8e-39	SMART
SR	719	819	1.1e-60	SMART
SR	824	927	4e-24	SMART
SR	930	1030	2.3e-55	SMART
transmembrane domain	1046	1068	N/A	INTRINSIC
low complexity region	1095	1107	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000112541
AA Change: E820*

SMART Domains

Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: E820*

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
SR	50	150	2.26e-50	SMART
SR	157	258	3.11e-53	SMART
SR	265	365	1.54e-57	SMART
SR	372	472	2.64e-33	SMART
SR	477	577	5.03e-39	SMART
SR	582	682	2.09e-36	SMART
SR	719	819	2.38e-58	SMART
SR	824	927	8.93e-22	SMART
SR	930	1030	5.06e-53	SMART
transmembrane domain	1046	1068	N/A	INTRINSIC
low complexity region	1095	1107	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203210

Meta Mutation Damage Score

0.9717

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	G	T	4: 144,349,779 (GRCm39)	E345D	probably damaging	Het
Adam7	T	A	14: 68,742,537 (GRCm39)	Q692L	probably benign	Het
Ankk1	A	C	9: 49,329,990 (GRCm39)	C322G	probably benign	Het
Ap3b2	C	T	7: 81,123,598 (GRCm39)		probably benign	Het
Apeh	T	C	9: 107,963,491 (GRCm39)	D577G	possibly damaging	Het
Aspm	T	A	1: 139,405,435 (GRCm39)	W1441R	probably damaging	Het
B4galt3	C	A	1: 171,101,613 (GRCm39)	H196N	probably damaging	Het
Cd38	T	A	5: 44,065,353 (GRCm39)		probably null	Het
Cdh15	G	A	8: 123,588,763 (GRCm39)	R279Q	probably damaging	Het
Enpp1	C	A	10: 24,527,239 (GRCm39)	Q649H	probably benign	Het
Garnl3	T	A	2: 32,954,046 (GRCm39)	R86S	probably damaging	Het
Gbe1	A	G	16: 70,233,909 (GRCm39)		probably null	Het
Gm5117	A	G	8: 32,229,223 (GRCm39)		noncoding transcript	Het
Hip1	A	T	5: 135,441,566 (GRCm39)	V568E	probably damaging	Het
Hspa14	G	A	2: 3,512,213 (GRCm39)		probably null	Het
Lrrc4	A	G	6: 28,831,451 (GRCm39)	F55L	probably benign	Het
Med31	T	A	11: 72,104,966 (GRCm39)	N35I	probably damaging	Het
Msi1	C	A	5: 115,574,568 (GRCm39)		probably benign	Het
Or1e34	T	C	11: 73,778,660 (GRCm39)	I179M	probably benign	Het
Or4b1	A	T	2: 89,980,062 (GRCm39)	L96Q	probably damaging	Het
Parl	T	C	16: 20,105,790 (GRCm39)	T211A	probably benign	Het
Ppwd1	T	C	13: 104,350,090 (GRCm39)	I432V	probably benign	Het
Scn10a	T	A	9: 119,467,753 (GRCm39)	I796F	probably damaging	Het
Semp2l2a	T	A	8: 13,886,951 (GRCm39)	E380V	probably damaging	Het
Sh3rf3	A	G	10: 58,842,895 (GRCm39)	D287G	probably damaging	Het
Sin3b	T	C	8: 73,450,780 (GRCm39)		probably null	Het
Ubr4	T	C	4: 139,160,984 (GRCm39)	I2493T	possibly damaging	Het
Uts2	T	A	4: 151,084,593 (GRCm39)		probably null	Het
Zfp109	T	C	7: 23,928,806 (GRCm39)	D201G	probably benign	Het
Zfp407	A	G	18: 84,578,005 (GRCm39)	F1036S	probably damaging	Het
Znrf3	T	C	11: 5,231,170 (GRCm39)	E685G	probably damaging	Het

Other mutations in Cd163

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Cd163	APN	6	124,306,060 (GRCm39)	splice site	probably benign
IGL00755:Cd163	APN	6	124,295,616 (GRCm39)	missense	possibly damaging	0.70
IGL01690:Cd163	APN	6	124,284,277 (GRCm39)	missense	possibly damaging	0.89
IGL02101:Cd163	APN	6	124,284,246 (GRCm39)	nonsense	probably null
IGL02733:Cd163	APN	6	124,302,300 (GRCm39)	missense	probably damaging	1.00
IGL02801:Cd163	APN	6	124,297,488 (GRCm39)	missense	probably benign	0.00
IGL02897:Cd163	APN	6	124,302,486 (GRCm39)	missense	probably damaging	1.00
IGL03074:Cd163	APN	6	124,294,945 (GRCm39)	missense	probably benign	0.00
IGL03283:Cd163	APN	6	124,286,158 (GRCm39)	missense	possibly damaging	0.49
compass	UTSW	6	124,306,045 (GRCm39)	makesense	probably null
hottish	UTSW	6	124,286,167 (GRCm39)	missense	probably damaging	1.00
protractor	UTSW	6	124,288,525 (GRCm39)	missense	probably damaging	1.00
t-square	UTSW	6	124,302,247 (GRCm39)	missense	probably damaging	0.97
R0494:Cd163	UTSW	6	124,288,408 (GRCm39)	missense	probably damaging	1.00
R0554:Cd163	UTSW	6	124,289,619 (GRCm39)	missense	probably benign	0.03
R0622:Cd163	UTSW	6	124,294,311 (GRCm39)	missense	probably damaging	1.00
R1004:Cd163	UTSW	6	124,302,306 (GRCm39)	missense	probably damaging	1.00
R1061:Cd163	UTSW	6	124,286,128 (GRCm39)	missense	probably benign	0.00
R1132:Cd163	UTSW	6	124,286,055 (GRCm39)	nonsense	probably null
R1195:Cd163	UTSW	6	124,302,209 (GRCm39)	splice site	probably benign
R1195:Cd163	UTSW	6	124,302,209 (GRCm39)	splice site	probably benign
R1436:Cd163	UTSW	6	124,304,890 (GRCm39)	missense	possibly damaging	0.47
R1463:Cd163	UTSW	6	124,288,406 (GRCm39)	missense	probably damaging	1.00
R1532:Cd163	UTSW	6	124,289,689 (GRCm39)	missense	possibly damaging	0.91
R1541:Cd163	UTSW	6	124,304,920 (GRCm39)	missense	probably benign
R1654:Cd163	UTSW	6	124,294,540 (GRCm39)	missense	probably damaging	1.00
R1717:Cd163	UTSW	6	124,306,547 (GRCm39)	utr 3 prime	probably benign
R1744:Cd163	UTSW	6	124,283,987 (GRCm39)	missense	possibly damaging	0.94
R2014:Cd163	UTSW	6	124,302,457 (GRCm39)	missense	probably damaging	0.99
R2035:Cd163	UTSW	6	124,297,588 (GRCm39)	missense	probably damaging	0.97
R2095:Cd163	UTSW	6	124,294,781 (GRCm39)	missense	probably damaging	1.00
R2124:Cd163	UTSW	6	124,295,815 (GRCm39)	missense	probably damaging	1.00
R2146:Cd163	UTSW	6	124,286,167 (GRCm39)	missense	probably damaging	1.00
R3854:Cd163	UTSW	6	124,288,525 (GRCm39)	missense	probably damaging	1.00
R4425:Cd163	UTSW	6	124,304,862 (GRCm39)	missense	possibly damaging	0.94
R4631:Cd163	UTSW	6	124,306,045 (GRCm39)	makesense	probably null
R4647:Cd163	UTSW	6	124,297,580 (GRCm39)	missense	probably damaging	1.00
R4713:Cd163	UTSW	6	124,294,577 (GRCm39)	critical splice donor site	probably null
R4803:Cd163	UTSW	6	124,289,389 (GRCm39)	missense	probably damaging	0.99
R4996:Cd163	UTSW	6	124,296,106 (GRCm39)	missense	probably benign	0.00
R5022:Cd163	UTSW	6	124,302,247 (GRCm39)	missense	probably damaging	0.97
R5023:Cd163	UTSW	6	124,302,247 (GRCm39)	missense	probably damaging	0.97
R5032:Cd163	UTSW	6	124,288,628 (GRCm39)	missense	probably damaging	1.00
R5057:Cd163	UTSW	6	124,302,247 (GRCm39)	missense	probably damaging	0.97
R5121:Cd163	UTSW	6	124,294,948 (GRCm39)	missense	probably damaging	1.00
R5436:Cd163	UTSW	6	124,304,923 (GRCm39)	missense	probably benign
R5453:Cd163	UTSW	6	124,289,500 (GRCm39)	missense	probably damaging	1.00
R5723:Cd163	UTSW	6	124,296,022 (GRCm39)	missense	probably benign	0.00
R5929:Cd163	UTSW	6	124,303,568 (GRCm39)	critical splice donor site	probably null
R5943:Cd163	UTSW	6	124,306,561 (GRCm39)	makesense	probably null
R5964:Cd163	UTSW	6	124,303,531 (GRCm39)	missense	probably benign	0.01
R5966:Cd163	UTSW	6	124,297,595 (GRCm39)	nonsense	probably null
R6279:Cd163	UTSW	6	124,294,950 (GRCm39)	nonsense	probably null
R6300:Cd163	UTSW	6	124,294,950 (GRCm39)	nonsense	probably null
R6499:Cd163	UTSW	6	124,281,703 (GRCm39)	missense	probably benign	0.00
R6602:Cd163	UTSW	6	124,288,594 (GRCm39)	missense	probably damaging	1.00
R6708:Cd163	UTSW	6	124,286,167 (GRCm39)	missense	probably damaging	1.00
R6767:Cd163	UTSW	6	124,281,738 (GRCm39)	missense	possibly damaging	0.56
R6979:Cd163	UTSW	6	124,294,945 (GRCm39)	missense	probably benign	0.00
R6993:Cd163	UTSW	6	124,294,673 (GRCm39)	missense	probably damaging	1.00
R7345:Cd163	UTSW	6	124,295,897 (GRCm39)	missense	possibly damaging	0.52
R7382:Cd163	UTSW	6	124,288,271 (GRCm39)	splice site	probably null
R7552:Cd163	UTSW	6	124,284,187 (GRCm39)	missense	probably benign	0.08
R7829:Cd163	UTSW	6	124,281,738 (GRCm39)	missense	probably benign	0.04
R8354:Cd163	UTSW	6	124,305,924 (GRCm39)	missense	probably benign	0.43
R8454:Cd163	UTSW	6	124,305,924 (GRCm39)	missense	probably benign	0.43
R8530:Cd163	UTSW	6	124,295,860 (GRCm39)	missense	probably damaging	1.00
R8560:Cd163	UTSW	6	124,294,360 (GRCm39)	missense	possibly damaging	0.86
R8878:Cd163	UTSW	6	124,297,469 (GRCm39)	missense	probably damaging	0.99
R8930:Cd163	UTSW	6	124,294,882 (GRCm39)	missense	probably damaging	1.00
R8932:Cd163	UTSW	6	124,294,882 (GRCm39)	missense	probably damaging	1.00
R9074:Cd163	UTSW	6	124,285,947 (GRCm39)	nonsense	probably null
R9408:Cd163	UTSW	6	124,297,497 (GRCm39)	missense	probably benign	0.39
R9530:Cd163	UTSW	6	124,294,491 (GRCm39)	nonsense	probably null
R9558:Cd163	UTSW	6	124,297,471 (GRCm39)	missense	probably benign	0.01
R9608:Cd163	UTSW	6	124,286,163 (GRCm39)	missense	possibly damaging	0.79
R9685:Cd163	UTSW	6	124,288,384 (GRCm39)	missense	possibly damaging	0.77
Z1177:Cd163	UTSW	6	124,294,344 (GRCm39)	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- CCGTCTGTGATGACAATTGGG -3'
(R):5'- GTACAAGCAAACACATGAGATTGTACC -3'

Sequencing Primer
(F):5'- CAATTGGGATATGACTGATGCC -3'
(R):5'- CACATGAGATTGTACCAACACGTTG -3'

Posted On

2014-10-30