Incidental Mutation 'R2353:Zfp109'
ID 246254
Institutional Source Beutler Lab
Gene Symbol Zfp109
Ensembl Gene ENSMUSG00000074283
Gene Name zinc finger protein 109
Synonyms
MMRRC Submission 040335-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R2353 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 23926997-23936985 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23928806 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 201 (D201G)
Ref Sequence ENSEMBL: ENSMUSP00000146043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037448] [ENSMUST00000206362] [ENSMUST00000206960]
AlphaFold A0A0U1RPC5
Predicted Effect probably benign
Transcript: ENSMUST00000037448
AA Change: D201G

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000045498
Gene: ENSMUSG00000074283
AA Change: D201G

DomainStartEndE-ValueType
KRAB 8 74 8.77e-20 SMART
ZnF_C2H2 283 305 2.91e-2 SMART
ZnF_C2H2 311 333 4.47e-3 SMART
ZnF_C2H2 339 361 4.11e-2 SMART
ZnF_C2H2 367 387 5.54e1 SMART
ZnF_C2H2 393 415 1.98e-4 SMART
ZnF_C2H2 421 443 8.67e-1 SMART
ZnF_C2H2 449 471 4.87e-4 SMART
ZnF_C2H2 477 499 7.49e-5 SMART
ZnF_C2H2 505 527 1.47e-3 SMART
ZnF_C2H2 533 555 3.21e-4 SMART
ZnF_C2H2 561 583 8.47e-4 SMART
ZnF_C2H2 589 611 2.57e-3 SMART
ZnF_C2H2 617 639 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206362
AA Change: D201G

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000206960
AA Change: D209G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.1035 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,349,779 (GRCm39) E345D probably damaging Het
Adam7 T A 14: 68,742,537 (GRCm39) Q692L probably benign Het
Ankk1 A C 9: 49,329,990 (GRCm39) C322G probably benign Het
Ap3b2 C T 7: 81,123,598 (GRCm39) probably benign Het
Apeh T C 9: 107,963,491 (GRCm39) D577G possibly damaging Het
Aspm T A 1: 139,405,435 (GRCm39) W1441R probably damaging Het
B4galt3 C A 1: 171,101,613 (GRCm39) H196N probably damaging Het
Cd163 G T 6: 124,296,115 (GRCm39) E820* probably null Het
Cd38 T A 5: 44,065,353 (GRCm39) probably null Het
Cdh15 G A 8: 123,588,763 (GRCm39) R279Q probably damaging Het
Enpp1 C A 10: 24,527,239 (GRCm39) Q649H probably benign Het
Garnl3 T A 2: 32,954,046 (GRCm39) R86S probably damaging Het
Gbe1 A G 16: 70,233,909 (GRCm39) probably null Het
Gm5117 A G 8: 32,229,223 (GRCm39) noncoding transcript Het
Hip1 A T 5: 135,441,566 (GRCm39) V568E probably damaging Het
Hspa14 G A 2: 3,512,213 (GRCm39) probably null Het
Lrrc4 A G 6: 28,831,451 (GRCm39) F55L probably benign Het
Med31 T A 11: 72,104,966 (GRCm39) N35I probably damaging Het
Msi1 C A 5: 115,574,568 (GRCm39) probably benign Het
Or1e34 T C 11: 73,778,660 (GRCm39) I179M probably benign Het
Or4b1 A T 2: 89,980,062 (GRCm39) L96Q probably damaging Het
Parl T C 16: 20,105,790 (GRCm39) T211A probably benign Het
Ppwd1 T C 13: 104,350,090 (GRCm39) I432V probably benign Het
Scn10a T A 9: 119,467,753 (GRCm39) I796F probably damaging Het
Semp2l2a T A 8: 13,886,951 (GRCm39) E380V probably damaging Het
Sh3rf3 A G 10: 58,842,895 (GRCm39) D287G probably damaging Het
Sin3b T C 8: 73,450,780 (GRCm39) probably null Het
Ubr4 T C 4: 139,160,984 (GRCm39) I2493T possibly damaging Het
Uts2 T A 4: 151,084,593 (GRCm39) probably null Het
Zfp407 A G 18: 84,578,005 (GRCm39) F1036S probably damaging Het
Znrf3 T C 11: 5,231,170 (GRCm39) E685G probably damaging Het
Other mutations in Zfp109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Zfp109 APN 7 23,928,237 (GRCm39) nonsense probably null
IGL01082:Zfp109 APN 7 23,933,784 (GRCm39) missense probably damaging 1.00
IGL02129:Zfp109 APN 7 23,936,054 (GRCm39) missense possibly damaging 0.76
PIT4585001:Zfp109 UTSW 7 23,928,779 (GRCm39) missense probably benign 0.35
R0319:Zfp109 UTSW 7 23,933,895 (GRCm39) missense probably damaging 1.00
R1502:Zfp109 UTSW 7 23,927,588 (GRCm39) missense probably damaging 1.00
R1912:Zfp109 UTSW 7 23,927,676 (GRCm39) missense probably damaging 0.97
R1930:Zfp109 UTSW 7 23,928,161 (GRCm39) missense probably damaging 1.00
R1931:Zfp109 UTSW 7 23,928,161 (GRCm39) missense probably damaging 1.00
R1994:Zfp109 UTSW 7 23,928,743 (GRCm39) missense probably benign 0.04
R2105:Zfp109 UTSW 7 23,936,041 (GRCm39) critical splice donor site probably null
R2219:Zfp109 UTSW 7 23,927,886 (GRCm39) missense probably damaging 1.00
R3754:Zfp109 UTSW 7 23,929,181 (GRCm39) missense probably benign 0.34
R4434:Zfp109 UTSW 7 23,928,771 (GRCm39) missense probably benign 0.02
R4884:Zfp109 UTSW 7 23,928,570 (GRCm39) missense probably benign 0.06
R5056:Zfp109 UTSW 7 23,928,162 (GRCm39) missense possibly damaging 0.75
R5220:Zfp109 UTSW 7 23,928,179 (GRCm39) missense probably benign 0.03
R5472:Zfp109 UTSW 7 23,928,046 (GRCm39) nonsense probably null
R5715:Zfp109 UTSW 7 23,928,995 (GRCm39) missense possibly damaging 0.92
R5801:Zfp109 UTSW 7 23,928,126 (GRCm39) missense probably damaging 0.99
R6092:Zfp109 UTSW 7 23,928,978 (GRCm39) missense possibly damaging 0.57
R6093:Zfp109 UTSW 7 23,928,558 (GRCm39) missense probably benign 0.03
R6334:Zfp109 UTSW 7 23,928,308 (GRCm39) missense probably damaging 0.96
R6458:Zfp109 UTSW 7 23,927,870 (GRCm39) missense probably benign 0.01
R6856:Zfp109 UTSW 7 23,928,823 (GRCm39) missense probably benign 0.03
R6879:Zfp109 UTSW 7 23,928,615 (GRCm39) missense probably benign 0.02
R7069:Zfp109 UTSW 7 23,928,785 (GRCm39) missense probably benign 0.01
R7151:Zfp109 UTSW 7 23,929,231 (GRCm39) missense probably benign 0.01
R7822:Zfp109 UTSW 7 23,928,570 (GRCm39) missense probably benign 0.06
R8205:Zfp109 UTSW 7 23,928,635 (GRCm39) missense probably damaging 0.99
R8492:Zfp109 UTSW 7 23,927,499 (GRCm39) missense possibly damaging 0.79
Z1088:Zfp109 UTSW 7 23,928,360 (GRCm39) missense probably benign 0.08
Z1177:Zfp109 UTSW 7 23,928,212 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGCTTTGTTCCTGCATG -3'
(R):5'- AAATTTCTGTCTGGGATTGCTCAG -3'

Sequencing Primer
(F):5'- CCTGCATGAACACTCTTTTGAATGG -3'
(R):5'- CTGTCTGGGATTGCTCAGTGTTC -3'
Posted On 2014-10-30