Incidental Mutation 'R2353:Zfp109'
ID246254
Institutional Source Beutler Lab
Gene Symbol Zfp109
Ensembl Gene ENSMUSG00000074283
Gene Namezinc finger protein 109
Synonyms
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24227572-24237560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24229381 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 201 (D201G)
Ref Sequence ENSEMBL: ENSMUSP00000146043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037448] [ENSMUST00000206362] [ENSMUST00000206960]
Predicted Effect probably benign
Transcript: ENSMUST00000037448
AA Change: D201G

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000045498
Gene: ENSMUSG00000074283
AA Change: D201G

DomainStartEndE-ValueType
KRAB 8 74 8.77e-20 SMART
ZnF_C2H2 283 305 2.91e-2 SMART
ZnF_C2H2 311 333 4.47e-3 SMART
ZnF_C2H2 339 361 4.11e-2 SMART
ZnF_C2H2 367 387 5.54e1 SMART
ZnF_C2H2 393 415 1.98e-4 SMART
ZnF_C2H2 421 443 8.67e-1 SMART
ZnF_C2H2 449 471 4.87e-4 SMART
ZnF_C2H2 477 499 7.49e-5 SMART
ZnF_C2H2 505 527 1.47e-3 SMART
ZnF_C2H2 533 555 3.21e-4 SMART
ZnF_C2H2 561 583 8.47e-4 SMART
ZnF_C2H2 589 611 2.57e-3 SMART
ZnF_C2H2 617 639 4.4e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206362
AA Change: D201G

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000206960
AA Change: D209G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.1035 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Zfp109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Zfp109 APN 7 24228812 nonsense probably null
IGL01082:Zfp109 APN 7 24234359 missense probably damaging 1.00
IGL02129:Zfp109 APN 7 24236629 missense possibly damaging 0.76
PIT4585001:Zfp109 UTSW 7 24229354 missense probably benign 0.35
R0319:Zfp109 UTSW 7 24234470 missense probably damaging 1.00
R1502:Zfp109 UTSW 7 24228163 missense probably damaging 1.00
R1912:Zfp109 UTSW 7 24228251 missense probably damaging 0.97
R1930:Zfp109 UTSW 7 24228736 missense probably damaging 1.00
R1931:Zfp109 UTSW 7 24228736 missense probably damaging 1.00
R1994:Zfp109 UTSW 7 24229318 missense probably benign 0.04
R2105:Zfp109 UTSW 7 24236616 critical splice donor site probably null
R2219:Zfp109 UTSW 7 24228461 missense probably damaging 1.00
R3754:Zfp109 UTSW 7 24229756 missense probably benign 0.34
R4434:Zfp109 UTSW 7 24229346 missense probably benign 0.02
R4884:Zfp109 UTSW 7 24229145 missense probably benign 0.06
R5056:Zfp109 UTSW 7 24228737 missense possibly damaging 0.75
R5220:Zfp109 UTSW 7 24228754 missense probably benign 0.03
R5472:Zfp109 UTSW 7 24228621 nonsense probably null
R5715:Zfp109 UTSW 7 24229570 missense possibly damaging 0.92
R5801:Zfp109 UTSW 7 24228701 missense probably damaging 0.99
R6092:Zfp109 UTSW 7 24229553 missense possibly damaging 0.57
R6093:Zfp109 UTSW 7 24229133 missense probably benign 0.03
R6334:Zfp109 UTSW 7 24228883 missense probably damaging 0.96
R6458:Zfp109 UTSW 7 24228445 missense probably benign 0.01
R6856:Zfp109 UTSW 7 24229398 missense probably benign 0.03
R6879:Zfp109 UTSW 7 24229190 missense probably benign 0.02
R7069:Zfp109 UTSW 7 24229360 missense probably benign 0.01
R7151:Zfp109 UTSW 7 24229806 missense probably benign 0.01
R7822:Zfp109 UTSW 7 24229145 missense probably benign 0.06
R8205:Zfp109 UTSW 7 24229210 missense probably damaging 0.99
R8492:Zfp109 UTSW 7 24228074 missense possibly damaging 0.79
Z1088:Zfp109 UTSW 7 24228935 missense probably benign 0.08
Z1177:Zfp109 UTSW 7 24228787 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGCTTTGTTCCTGCATG -3'
(R):5'- AAATTTCTGTCTGGGATTGCTCAG -3'

Sequencing Primer
(F):5'- CCTGCATGAACACTCTTTTGAATGG -3'
(R):5'- CTGTCTGGGATTGCTCAGTGTTC -3'
Posted On2014-10-30