Incidental Mutation 'R2353:Gm5117'
ID246257
Institutional Source Beutler Lab
Gene Symbol Gm5117
Ensembl Gene ENSMUSG00000093862
Gene Namepredicted gene 5117
Synonyms
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.867) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location31737208-31739760 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 31739195 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178878
SMART Domains Protein: ENSMUSP00000137046
Gene: ENSMUSG00000093862

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
low complexity region 608 627 N/A INTRINSIC
Pfam:Met_10 666 799 1.5e-9 PFAM
Pfam:UPF0020 672 770 4e-8 PFAM
Pfam:Methyltransf_18 687 815 5e-10 PFAM
Pfam:Methyltransf_31 688 801 1.5e-10 PFAM
Pfam:Methyltransf_26 688 803 1e-8 PFAM
Pfam:Methyltransf_15 688 842 5e-48 PFAM
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Gm5117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Gm5117 APN 8 31738487 exon noncoding transcript
IGL01362:Gm5117 APN 8 31737919 exon noncoding transcript
IGL01972:Gm5117 APN 8 31737759 exon noncoding transcript
IGL02100:Gm5117 APN 8 31737384 exon noncoding transcript
IGL02339:Gm5117 APN 8 31738226 exon noncoding transcript
IGL02366:Gm5117 APN 8 31737859 exon noncoding transcript
IGL02505:Gm5117 APN 8 31738316 exon noncoding transcript
IGL02698:Gm5117 APN 8 31739739 exon noncoding transcript
IGL03310:Gm5117 APN 8 31738808 exon noncoding transcript
IGL02835:Gm5117 UTSW 8 31737170 unclassified noncoding transcript
R1816:Gm5117 UTSW 8 31738958 exon noncoding transcript
R2157:Gm5117 UTSW 8 31738194 exon noncoding transcript
R2404:Gm5117 UTSW 8 31737278 exon noncoding transcript
R2408:Gm5117 UTSW 8 31737278 exon noncoding transcript
R2409:Gm5117 UTSW 8 31737278 exon noncoding transcript
R2510:Gm5117 UTSW 8 31738355 exon noncoding transcript
R4686:Gm5117 UTSW 8 31739256 exon noncoding transcript
R4953:Gm5117 UTSW 8 31738580 exon noncoding transcript
R5244:Gm5117 UTSW 8 31738277 exon noncoding transcript
R5275:Gm5117 UTSW 8 31739567 exon noncoding transcript
R5329:Gm5117 UTSW 8 31737882 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTTGTGAGGCAGCAAAAGTCC -3'
(R):5'- TTTAGATGAAATGGTTCGGGAATCC -3'

Sequencing Primer
(F):5'- TGAGCCTCACAACACTGAAATTGTTC -3'
(R):5'- TTCGGGAATCCTGGAGAAATGAC -3'
Posted On2014-10-30