Incidental Mutation 'R2353:Ankk1'
ID246260
Institutional Source Beutler Lab
Gene Symbol Ankk1
Ensembl Gene ENSMUSG00000032257
Gene Nameankyrin repeat and kinase domain containing 1
Synonyms9930020N01Rik
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location49415194-49427021 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 49418690 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 322 (C322G)
Ref Sequence ENSEMBL: ENSMUSP00000034792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034792]
Predicted Effect probably benign
Transcript: ENSMUST00000034792
AA Change: C322G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034792
Gene: ENSMUSG00000032257
AA Change: C322G

DomainStartEndE-ValueType
Pfam:Pkinase 35 298 4.1e-44 PFAM
Pfam:Pkinase_Tyr 36 297 7.6e-47 PFAM
ANK 369 398 1.36e-2 SMART
ANK 402 431 4.13e-2 SMART
ANK 435 464 3.51e-5 SMART
ANK 468 497 5.62e-4 SMART
ANK 501 530 5.71e-5 SMART
ANK 534 563 1.05e-3 SMART
ANK 567 596 1.12e-3 SMART
ANK 600 629 6.12e-5 SMART
ANK 633 662 1.59e-3 SMART
ANK 666 695 3.65e-3 SMART
ANK 699 728 8.39e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000216227
AA Change: C54G
Meta Mutation Damage Score 0.1451 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr protein kinase family, and protein kinase superfamily involved in signal transduction pathways. This gene is closely linked to DRD2 gene (GeneID:1813) on chr 11, and a well studied restriction fragment length polymorphism (RFLP) designated TaqIA, was originally associated with the DRD2 gene, however, later was determined to be located in exon 8 of ANKK1 gene (PMIDs: 18621654, 15146457), where it causes a nonconservative amino acid substitution. It is not clear if this gene plays any role in neuropsychiatric disorders previously associated with Taq1A RFLP. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Ankk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ankk1 APN 9 49421900 missense probably benign 0.30
IGL00495:Ankk1 APN 9 49415843 missense probably benign 0.00
IGL01316:Ankk1 APN 9 49420484 unclassified probably benign
IGL01359:Ankk1 APN 9 49416028 missense possibly damaging 0.95
IGL01464:Ankk1 APN 9 49415972 missense probably benign 0.26
IGL01719:Ankk1 APN 9 49416781 missense probably benign 0.08
IGL02057:Ankk1 APN 9 49416772 missense probably damaging 1.00
IGL02549:Ankk1 APN 9 49418693 missense probably damaging 1.00
IGL02690:Ankk1 APN 9 49421900 missense probably damaging 0.99
IGL03083:Ankk1 APN 9 49421866 missense probably benign 0.15
IGL03168:Ankk1 APN 9 49415768 missense possibly damaging 0.89
IGL03289:Ankk1 APN 9 49415695 missense probably benign 0.00
R0319:Ankk1 UTSW 9 49416071 missense probably damaging 0.97
R0539:Ankk1 UTSW 9 49418030 missense probably benign
R0827:Ankk1 UTSW 9 49421737 missense possibly damaging 0.81
R1474:Ankk1 UTSW 9 49415839 missense probably damaging 1.00
R1818:Ankk1 UTSW 9 49420425 missense probably benign 0.06
R1851:Ankk1 UTSW 9 49415850 missense probably benign
R2044:Ankk1 UTSW 9 49419364 critical splice donor site probably null
R2088:Ankk1 UTSW 9 49421965 unclassified probably benign
R2897:Ankk1 UTSW 9 49421822 missense probably benign 0.00
R2898:Ankk1 UTSW 9 49421822 missense probably benign 0.00
R3121:Ankk1 UTSW 9 49426967 missense probably benign 0.21
R3714:Ankk1 UTSW 9 49421713 missense possibly damaging 0.92
R4455:Ankk1 UTSW 9 49418066 missense probably benign 0.00
R4757:Ankk1 UTSW 9 49415930 missense probably benign
R4893:Ankk1 UTSW 9 49415683 missense probably benign 0.00
R5090:Ankk1 UTSW 9 49421763 missense probably damaging 0.98
R5521:Ankk1 UTSW 9 49420448 missense probably benign 0.05
R5812:Ankk1 UTSW 9 49426853 missense probably benign 0.00
R5853:Ankk1 UTSW 9 49418695 missense possibly damaging 0.58
R5873:Ankk1 UTSW 9 49415896 missense probably benign 0.19
R6119:Ankk1 UTSW 9 49426883 missense possibly damaging 0.88
R6328:Ankk1 UTSW 9 49416071 missense possibly damaging 0.84
R6606:Ankk1 UTSW 9 49416346 missense probably benign 0.29
R6689:Ankk1 UTSW 9 49420476 missense probably damaging 1.00
R6745:Ankk1 UTSW 9 49416180 missense probably benign 0.00
R6856:Ankk1 UTSW 9 49420020 missense probably benign 0.39
R7424:Ankk1 UTSW 9 49418750 missense possibly damaging 0.93
R8145:Ankk1 UTSW 9 49415797 missense possibly damaging 0.63
R8683:Ankk1 UTSW 9 49417992 missense
Z1176:Ankk1 UTSW 9 49416643 missense probably benign 0.01
Z1176:Ankk1 UTSW 9 49421911 missense probably damaging 1.00
Z1177:Ankk1 UTSW 9 49415944 missense probably damaging 0.99
Z1177:Ankk1 UTSW 9 49416487 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCTAGCTTCACTTATGGTTCC -3'
(R):5'- TTGTGGGCAAATGGAAACGTAC -3'

Sequencing Primer
(F):5'- GGTTCCCACACCACCCTGAG -3'
(R):5'- AAACGTACATAAACCTAGGAATGTG -3'
Posted On2014-10-30