Incidental Mutation 'R2353:Apeh'
ID246261
Institutional Source Beutler Lab
Gene Symbol Apeh
Ensembl Gene ENSMUSG00000032590
Gene Nameacylpeptide hydrolase
SynonymsN-acylaminoacyl peptide hydrolase
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108085413-108094606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108086292 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 577 (D577G)
Ref Sequence ENSEMBL: ENSMUSP00000141856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035211] [ENSMUST00000159372] [ENSMUST00000160249] [ENSMUST00000162886] [ENSMUST00000193254]
Predicted Effect probably benign
Transcript: ENSMUST00000035211
SMART Domains Protein: ENSMUSP00000035211
Gene: ENSMUSG00000032591

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 8.57e-46 SMART
KR 290 372 7.94e-41 SMART
KR 377 459 6.59e-47 SMART
Tryp_SPc 488 709 2.27e-55 SMART
Predicted Effect unknown
Transcript: ENSMUST00000081309
AA Change: D560G
SMART Domains Protein: ENSMUSP00000080058
Gene: ENSMUSG00000032590
AA Change: D560G

DomainStartEndE-ValueType
Pfam:DLH 485 721 2e-8 PFAM
Pfam:Abhydrolase_1 501 633 3.8e-9 PFAM
Pfam:Abhydrolase_5 501 708 5e-16 PFAM
Pfam:Peptidase_S9 516 732 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159372
Predicted Effect probably benign
Transcript: ENSMUST00000160184
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161253
Predicted Effect probably benign
Transcript: ENSMUST00000162886
SMART Domains Protein: ENSMUSP00000125175
Gene: ENSMUSG00000032591

DomainStartEndE-ValueType
PAN_AP 21 104 2.65e-9 SMART
KR 108 188 3.13e-39 SMART
KR 189 270 1.07e-46 SMART
KR 281 363 7.94e-41 SMART
KR 368 450 6.59e-47 SMART
Tryp_SPc 479 700 2.27e-55 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192916
Predicted Effect possibly damaging
Transcript: ENSMUST00000193254
AA Change: D577G

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141856
Gene: ENSMUSG00000032590
AA Change: D577G

DomainStartEndE-ValueType
Pfam:DLH 485 721 4.8e-8 PFAM
Pfam:Abhydrolase_5 501 708 5.7e-16 PFAM
Pfam:Abhydrolase_6 503 714 6.2e-14 PFAM
Pfam:Peptidase_S9 515 732 1.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194915
Meta Mutation Damage Score 0.4799 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme acylpeptide hydrolase, which catalyzes the hydrolysis of the terminal acetylated amino acid preferentially from small acetylated peptides. The acetyl amino acid formed by this hydrolase is further processed to acetate and a free amino acid by an aminoacylase. This gene is located within the same region of chromosome 3 (3p21) as the aminoacylase gene, and deletions at this locus are also associated with a decrease in aminoacylase activity. The acylpeptide hydrolase is a homotetrameric protein of 300 kDa with each subunit consisting of 732 amino acid residues. It can play an important role in destroying oxidatively damaged proteins in living cells. Deletions of this gene locus are found in various types of carcinomas, including small cell lung carcinoma and renal cell carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Apeh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Apeh APN 9 108086207 missense probably benign
IGL02232:Apeh APN 9 108091872 missense probably benign 0.02
IGL02563:Apeh APN 9 108093709 missense possibly damaging 0.85
IGL02713:Apeh APN 9 108085672 missense probably damaging 1.00
IGL02794:Apeh APN 9 108092010 missense possibly damaging 0.94
IGL03355:Apeh APN 9 108086445 missense probably benign 0.00
R6807_Apeh_606 UTSW 9 108092679 missense probably damaging 1.00
R0511:Apeh UTSW 9 108087055 missense probably benign
R1221:Apeh UTSW 9 108092609 missense probably benign
R1574:Apeh UTSW 9 108092726 splice site probably null
R1863:Apeh UTSW 9 108092103 missense possibly damaging 0.91
R2126:Apeh UTSW 9 108085667 missense probably damaging 1.00
R4930:Apeh UTSW 9 108087825 missense probably benign
R5156:Apeh UTSW 9 108094287 missense probably damaging 1.00
R5278:Apeh UTSW 9 108091258 missense probably benign 0.08
R5366:Apeh UTSW 9 108091806 missense probably benign 0.01
R5384:Apeh UTSW 9 108086463 missense probably damaging 1.00
R5940:Apeh UTSW 9 108091899 splice site probably null
R6102:Apeh UTSW 9 108086439 missense probably damaging 1.00
R6300:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6368:Apeh UTSW 9 108087243 missense probably damaging 1.00
R6807:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6809:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6817:Apeh UTSW 9 108092679 missense probably damaging 1.00
R6828:Apeh UTSW 9 108087038 missense probably damaging 1.00
R6866:Apeh UTSW 9 108092679 missense probably damaging 1.00
R7034:Apeh UTSW 9 108094271 missense possibly damaging 0.70
R7036:Apeh UTSW 9 108094271 missense possibly damaging 0.70
R7139:Apeh UTSW 9 108092146 missense probably damaging 1.00
R8024:Apeh UTSW 9 108092591 missense probably benign 0.20
R8289:Apeh UTSW 9 108086245 missense probably damaging 0.99
R8731:Apeh UTSW 9 108087223 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCAGGGACCTTTAATGC -3'
(R):5'- TTAGTGAACTATCGTGGTTCCAC -3'

Sequencing Primer
(F):5'- GCAGGGACCTTTAATGCACACTC -3'
(R):5'- GCTTTGGCCAAGACAGCATC -3'
Posted On2014-10-30