Incidental Mutation 'R2353:Scn10a'
ID246262
Institutional Source Beutler Lab
Gene Symbol Scn10a
Ensembl Gene ENSMUSG00000034533
Gene Namesodium channel, voltage-gated, type X, alpha
SynonymsNav1.8
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119608456-119719032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119638687 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 796 (I796F)
Ref Sequence ENSEMBL: ENSMUSP00000081845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084787] [ENSMUST00000213392] [ENSMUST00000214408]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084787
AA Change: I796F

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081845
Gene: ENSMUSG00000034533
AA Change: I796F

DomainStartEndE-ValueType
Pfam:Ion_trans 129 406 7.9e-77 PFAM
low complexity region 557 572 N/A INTRINSIC
Pfam:Ion_trans 663 898 6.8e-53 PFAM
Pfam:Na_trans_assoc 903 1148 2.7e-57 PFAM
Pfam:Ion_trans 1152 1429 8.1e-66 PFAM
Pfam:Ion_trans 1476 1734 1.9e-55 PFAM
Pfam:PKD_channel 1561 1729 3.4e-8 PFAM
IQ 1851 1873 7.57e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000213392
AA Change: I796F

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214408
AA Change: I796F

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
MGI Phenotype Homozygotes for a targeted null mutation exhibit impaired perception of pain.
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 noncoding transcript Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm13177 G T 4: 144,623,209 E345D probably damaging Het
Gm5117 A G 8: 31,739,195 L190P probably damaging Het
Hip1 A T 5: 135,412,712 V979E probably damaging Het
Hspa14 G A 2: 3,511,176 Q46* probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 A11S unknown Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E781G probably damaging Het
Other mutations in Scn10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn10a APN 9 119672226 missense probably damaging 1.00
IGL01339:Scn10a APN 9 119622766 unclassified probably damaging 1.00
IGL01467:Scn10a APN 9 119658412 missense probably benign 0.33
IGL01472:Scn10a APN 9 119617763 missense probably damaging 1.00
IGL01481:Scn10a APN 9 119609194 missense possibly damaging 0.71
IGL01539:Scn10a APN 9 119638698 missense possibly damaging 0.95
IGL01580:Scn10a APN 9 119627159 missense probably damaging 1.00
IGL01676:Scn10a APN 9 119672165 nonsense probably null
IGL01681:Scn10a APN 9 119694077 missense probably damaging 1.00
IGL01748:Scn10a APN 9 119627084 missense probably damaging 1.00
IGL01866:Scn10a APN 9 119635502 nonsense probably null
IGL01998:Scn10a APN 9 119609676 missense probably damaging 1.00
IGL02015:Scn10a APN 9 119664951 unclassified probably benign 0.08
IGL02098:Scn10a APN 9 119691478 missense possibly damaging 0.90
IGL02113:Scn10a APN 9 119609890 missense probably damaging 1.00
IGL02245:Scn10a APN 9 119672152 missense probably damaging 1.00
IGL02262:Scn10a APN 9 119658433 missense probably benign 0.07
IGL02317:Scn10a APN 9 119638555 missense probably benign 0.00
IGL02428:Scn10a APN 9 119691562 unclassified probably damaging 1.00
IGL02439:Scn10a APN 9 119618848 missense probably benign 0.40
IGL02583:Scn10a APN 9 119691440 unclassified 0.00
IGL02597:Scn10a APN 9 119610123 missense probably damaging 0.99
IGL02680:Scn10a APN 9 119666059 missense probably damaging 1.00
IGL02733:Scn10a APN 9 119616705 missense probably damaging 1.00
IGL02851:Scn10a APN 9 119671608 missense probably damaging 1.00
IGL02992:Scn10a APN 9 119609560 missense possibly damaging 0.90
IGL03040:Scn10a APN 9 119622985 missense probably damaging 1.00
IGL03049:Scn10a APN 9 119665990 missense probably damaging 1.00
IGL03407:Scn10a APN 9 119648171 missense probably damaging 0.99
Possum UTSW 9 119638705 missense probably damaging 1.00
R0025:Scn10a UTSW 9 119670484 missense probably damaging 1.00
R0030:Scn10a UTSW 9 119669990 missense possibly damaging 0.71
R0328:Scn10a UTSW 9 119694102 missense possibly damaging 0.92
R0494:Scn10a UTSW 9 119624100 missense probably damaging 1.00
R0511:Scn10a UTSW 9 119613700 missense probably damaging 0.99
R0548:Scn10a UTSW 9 119665928 missense probably benign 0.00
R0584:Scn10a UTSW 9 119670531 missense probably damaging 1.00
R0595:Scn10a UTSW 9 119666063 missense probably benign 0.11
R0894:Scn10a UTSW 9 119630147 missense probably damaging 1.00
R1022:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1024:Scn10a UTSW 9 119609274 missense probably damaging 1.00
R1263:Scn10a UTSW 9 119617733 missense probably damaging 1.00
R1456:Scn10a UTSW 9 119691478 missense possibly damaging 0.51
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1466:Scn10a UTSW 9 119666490 missense probably damaging 1.00
R1573:Scn10a UTSW 9 119613626 missense probably benign 0.04
R1704:Scn10a UTSW 9 119609394 missense probably damaging 1.00
R1933:Scn10a UTSW 9 119609998 missense probably benign 0.43
R1945:Scn10a UTSW 9 119691454 missense probably damaging 0.96
R2013:Scn10a UTSW 9 119613736 missense probably benign 0.21
R2155:Scn10a UTSW 9 119609448 missense probably benign 0.02
R2196:Scn10a UTSW 9 119609004 missense probably benign
R2231:Scn10a UTSW 9 119633850 missense possibly damaging 0.73
R2392:Scn10a UTSW 9 119627202 missense possibly damaging 0.86
R2895:Scn10a UTSW 9 119661401 missense probably benign 0.23
R2926:Scn10a UTSW 9 119638701 missense possibly damaging 0.85
R3783:Scn10a UTSW 9 119691562 missense probably damaging 1.00
R3821:Scn10a UTSW 9 119638633 missense probably benign 0.23
R4003:Scn10a UTSW 9 119608968 missense probably null 0.00
R4208:Scn10a UTSW 9 119616776 missense probably damaging 0.99
R4231:Scn10a UTSW 9 119631544 missense probably damaging 0.98
R4626:Scn10a UTSW 9 119631505 missense possibly damaging 0.87
R4702:Scn10a UTSW 9 119633791 missense possibly damaging 0.59
R4713:Scn10a UTSW 9 119609651 missense probably damaging 1.00
R4729:Scn10a UTSW 9 119671526 missense probably damaging 1.00
R4782:Scn10a UTSW 9 119622910 missense possibly damaging 0.70
R4822:Scn10a UTSW 9 119638672 missense probably damaging 1.00
R4856:Scn10a UTSW 9 119694309 missense probably benign 0.12
R4856:Scn10a UTSW 9 119694310 missense possibly damaging 0.49
R4932:Scn10a UTSW 9 119687874 splice site probably null
R5015:Scn10a UTSW 9 119622921 missense possibly damaging 0.93
R5193:Scn10a UTSW 9 119609655 missense probably damaging 1.00
R5211:Scn10a UTSW 9 119661232 missense probably damaging 0.99
R5320:Scn10a UTSW 9 119648109 missense probably damaging 1.00
R5400:Scn10a UTSW 9 119609034 missense probably damaging 0.99
R5448:Scn10a UTSW 9 119687947 missense possibly damaging 0.69
R5457:Scn10a UTSW 9 119694127 missense probably damaging 1.00
R5554:Scn10a UTSW 9 119694130 missense probably benign 0.07
R5680:Scn10a UTSW 9 119624136 missense probably damaging 1.00
R5762:Scn10a UTSW 9 119635441 critical splice donor site probably null
R5935:Scn10a UTSW 9 119627171 missense probably damaging 0.99
R5956:Scn10a UTSW 9 119631560 missense probably damaging 1.00
R6041:Scn10a UTSW 9 119609469 missense probably damaging 1.00
R6047:Scn10a UTSW 9 119622831 missense probably benign 0.20
R6132:Scn10a UTSW 9 119613695 missense probably damaging 0.99
R6156:Scn10a UTSW 9 119635583 missense probably benign
R6309:Scn10a UTSW 9 119624115 missense possibly damaging 0.95
R6318:Scn10a UTSW 9 119627115 missense probably damaging 1.00
R6394:Scn10a UTSW 9 119661320 missense probably benign 0.36
X0058:Scn10a UTSW 9 119609364 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCATGCAGACCCACATGTTC -3'
(R):5'- AACTCATGAGATGTCTTGGTGC -3'

Sequencing Primer
(F):5'- GCAGACCCACATGTTCTCGATC -3'
(R):5'- CACAAGCTTGGCTTCCAGTGAAG -3'
Posted OnOct 30, 2014