Incidental Mutation 'R2353:Znrf3'
ID246265
Institutional Source Beutler Lab
Gene Symbol Znrf3
Ensembl Gene ENSMUSG00000041961
Gene Namezinc and ring finger 3
SynonymsLOC382477
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location5276324-5444847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5281170 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 685 (E685G)
Ref Sequence ENSEMBL: ENSMUSP00000134698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109867] [ENSMUST00000172492]
Predicted Effect probably damaging
Transcript: ENSMUST00000109867
AA Change: E781G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105493
Gene: ENSMUSG00000041961
AA Change: E781G

DomainStartEndE-ValueType
signal peptide 1 52 N/A INTRINSIC
PDB:4CDK|D 53 205 1e-103 PDB
transmembrane domain 218 235 N/A INTRINSIC
RING 290 330 1.56e-6 SMART
low complexity region 442 455 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
low complexity region 895 913 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172492
AA Change: E685G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134698
Gene: ENSMUSG00000041961
AA Change: E685G

DomainStartEndE-ValueType
PDB:4CDK|D 2 109 5e-70 PDB
transmembrane domain 122 139 N/A INTRINSIC
RING 194 234 1.56e-6 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 449 471 N/A INTRINSIC
Meta Mutation Damage Score 0.2140 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit complete lethality around birth, aphakia, abnormal lens development and defective enural tube closure in some mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Other mutations in Znrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Znrf3 APN 11 5289039 missense probably damaging 1.00
IGL01387:Znrf3 APN 11 5338656 nonsense probably null
IGL02895:Znrf3 APN 11 5289085 missense probably damaging 0.97
R0788:Znrf3 UTSW 11 5281320 missense probably benign 0.04
R1383:Znrf3 UTSW 11 5281994 missense probably damaging 0.96
R1544:Znrf3 UTSW 11 5289066 missense probably damaging 1.00
R1556:Znrf3 UTSW 11 5281347 missense probably benign 0.01
R1586:Znrf3 UTSW 11 5281477 missense probably damaging 1.00
R1852:Znrf3 UTSW 11 5287455 missense possibly damaging 0.94
R1864:Znrf3 UTSW 11 5283373 missense possibly damaging 0.95
R1927:Znrf3 UTSW 11 5281062 missense probably benign 0.28
R2884:Znrf3 UTSW 11 5289693 missense probably damaging 1.00
R2885:Znrf3 UTSW 11 5289693 missense probably damaging 1.00
R4021:Znrf3 UTSW 11 5281278 missense possibly damaging 0.68
R4811:Znrf3 UTSW 11 5287420 missense probably benign 0.07
R4935:Znrf3 UTSW 11 5283422 missense probably damaging 1.00
R5218:Znrf3 UTSW 11 5281519 missense possibly damaging 0.95
R5584:Znrf3 UTSW 11 5286218 missense probably damaging 1.00
R5698:Znrf3 UTSW 11 5289006 intron probably benign
R5715:Znrf3 UTSW 11 5286239 missense possibly damaging 0.91
R5900:Znrf3 UTSW 11 5282110 missense probably damaging 0.98
R5988:Znrf3 UTSW 11 5281776 missense probably damaging 1.00
R6253:Znrf3 UTSW 11 5280865 missense probably benign 0.14
R7057:Znrf3 UTSW 11 5282442 missense probably benign 0.00
R7062:Znrf3 UTSW 11 5281550 missense probably damaging 1.00
R7410:Znrf3 UTSW 11 5288955 missense unknown
R7881:Znrf3 UTSW 11 5444533 missense unknown
Z1177:Znrf3 UTSW 11 5286168 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTGTGCCTAGACTCCAGTGG -3'
(R):5'- GCAGTTTATTCCTGGGTCCTCG -3'

Sequencing Primer
(F):5'- GAACGTCCAAGCTCAGTGC -3'
(R):5'- TCCTCGAGGACTGCAACC -3'
Posted On2014-10-30