Incidental Mutation 'R2353:Med31'
ID246266
Institutional Source Beutler Lab
Gene Symbol Med31
Ensembl Gene ENSMUSG00000020801
Gene Namemediator complex subunit 31
Synonyms3110004H13Rik, l11Jus15
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72211724-72215592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72214140 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 35 (N35I)
Ref Sequence ENSEMBL: ENSMUSP00000021157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021157] [ENSMUST00000021158]
Predicted Effect probably damaging
Transcript: ENSMUST00000021157
AA Change: N35I

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021157
Gene: ENSMUSG00000020801
AA Change: N35I

DomainStartEndE-ValueType
Pfam:Med31 15 109 2.7e-43 PFAM
low complexity region 115 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021158
SMART Domains Protein: ENSMUSP00000021158
Gene: ENSMUSG00000020803

DomainStartEndE-ValueType
Pfam:DUF953 8 122 7.4e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129264
Meta Mutation Damage Score 0.5230 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit developmental delay, reduced cell proliferation, reduced ossification and chondrogenesis, and death during late-gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Med31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Med31 APN 11 72212079 splice site probably null
IGL02510:Med31 APN 11 72212056 missense probably benign 0.12
R0627:Med31 UTSW 11 72213775 critical splice donor site probably null
R0815:Med31 UTSW 11 72213831 missense probably damaging 1.00
R1971:Med31 UTSW 11 72215418 start gained probably benign
R3964:Med31 UTSW 11 72211929 missense probably benign 0.01
R3965:Med31 UTSW 11 72211929 missense probably benign 0.01
R3966:Med31 UTSW 11 72211929 missense probably benign 0.01
R4883:Med31 UTSW 11 72214149 missense possibly damaging 0.49
R8255:Med31 UTSW 11 72215468 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AACCGCTGGACTACTGATTAG -3'
(R):5'- ACAGGGCCTCATTACTTAGTG -3'

Sequencing Primer
(F):5'- CCGCTGGACTACTGATTAGTAATC -3'
(R):5'- ATATATATACACACACACACACACAC -3'
Posted On2014-10-30