Incidental Mutation 'R2353:Olfr394'
ID246267
Institutional Source Beutler Lab
Gene Symbol Olfr394
Ensembl Gene ENSMUSG00000056921
Gene Nameolfactory receptor 394
SynonymsMOR135-8, GA_x6K02T2P1NL-4043306-4042374
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73883337-73890771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73887834 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 179 (I179M)
Ref Sequence ENSEMBL: ENSMUSP00000149527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071478] [ENSMUST00000214284] [ENSMUST00000216608]
Predicted Effect probably benign
Transcript: ENSMUST00000071478
AA Change: I179M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000071415
Gene: ENSMUSG00000056921
AA Change: I179M

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.4e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4e-7 PFAM
Pfam:7tm_1 39 288 1.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214284
AA Change: I179M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000216608
AA Change: I179M

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Olfr394
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Olfr394 APN 11 73888249 missense probably damaging 1.00
IGL01655:Olfr394 APN 11 73887927 missense probably benign 0.01
IGL02173:Olfr394 APN 11 73888123 missense possibly damaging 0.72
IGL02308:Olfr394 APN 11 73888295 missense probably benign 0.09
IGL02656:Olfr394 APN 11 73888039 missense probably damaging 0.98
R0079:Olfr394 UTSW 11 73887737 missense probably benign 0.22
R0119:Olfr394 UTSW 11 73887830 missense probably benign 0.11
R0136:Olfr394 UTSW 11 73887785 missense probably benign 0.00
R0136:Olfr394 UTSW 11 73887830 missense probably benign 0.11
R0255:Olfr394 UTSW 11 73887829 missense probably benign
R0545:Olfr394 UTSW 11 73888017 nonsense probably null
R0599:Olfr394 UTSW 11 73887904 missense probably benign 0.19
R0655:Olfr394 UTSW 11 73887805 missense possibly damaging 0.88
R0657:Olfr394 UTSW 11 73887785 missense probably benign 0.00
R0657:Olfr394 UTSW 11 73887830 missense probably benign 0.11
R0720:Olfr394 UTSW 11 73887862 missense probably benign 0.12
R1112:Olfr394 UTSW 11 73888234 missense probably damaging 0.99
R2924:Olfr394 UTSW 11 73887511 missense probably damaging 0.99
R4583:Olfr394 UTSW 11 73887803 missense probably damaging 1.00
R5231:Olfr394 UTSW 11 73887955 missense probably damaging 1.00
R5537:Olfr394 UTSW 11 73887697 missense probably benign 0.02
R5806:Olfr394 UTSW 11 73887547 missense probably damaging 0.99
R7131:Olfr394 UTSW 11 73887954 nonsense probably null
R7325:Olfr394 UTSW 11 73888275 missense probably benign 0.19
R7361:Olfr394 UTSW 11 73888001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCCCATAGAACAGAGACAC -3'
(R):5'- TATGACCGCTATGTGGCCATC -3'

Sequencing Primer
(F):5'- CCACAGGTAGAGAAGACCTTGTG -3'
(R):5'- GCTATGTGGCCATCTGCTTC -3'
Posted On2014-10-30