Incidental Mutation 'R2353:Adam7'
ID246270
Institutional Source Beutler Lab
Gene Symbol Adam7
Ensembl Gene ENSMUSG00000022056
Gene Namea disintegrin and metallopeptidase domain 7
SynonymsEAP1
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location68497336-68533741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68505088 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 692 (Q692L)
Ref Sequence ENSEMBL: ENSMUSP00000022640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022640]
Predicted Effect probably benign
Transcript: ENSMUST00000022640
AA Change: Q692L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000022640
Gene: ENSMUSG00000022056
AA Change: Q692L

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 25 156 1.6e-28 PFAM
Pfam:Reprolysin_5 197 378 1.2e-12 PFAM
Pfam:Reprolysin_4 197 382 2.6e-12 PFAM
Pfam:Reprolysin 199 393 1.3e-70 PFAM
Pfam:Reprolysin_2 219 383 1.1e-9 PFAM
Pfam:Reprolysin_3 223 346 9.5e-14 PFAM
DISIN 410 485 8.79e-30 SMART
ACR 486 623 3.51e-58 SMART
transmembrane domain 667 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128069
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is specifically expressed in epididymis where the encoded protein is transferred to the sperm surface during epididymal transit. This gene is located adjacent to a related gene from the ADAM family of proteins on chromosome 14. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility with decreased cell height in caput epididymis, spermatic granuloma, kinked sperm flagellum and reduced sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Parl T C 16: 20,287,040 T211A probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Adam7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Adam7 APN 14 68521938 missense possibly damaging 0.68
IGL01418:Adam7 APN 14 68525206 missense probably benign
IGL01934:Adam7 APN 14 68532599 missense probably damaging 1.00
IGL02655:Adam7 APN 14 68516611 missense probably damaging 1.00
IGL02669:Adam7 APN 14 68507894 missense probably damaging 1.00
PIT4445001:Adam7 UTSW 14 68509748 missense possibly damaging 0.88
R0195:Adam7 UTSW 14 68527627 splice site probably benign
R0277:Adam7 UTSW 14 68510857 splice site probably null
R0362:Adam7 UTSW 14 68509656 splice site probably benign
R0440:Adam7 UTSW 14 68510856 splice site probably null
R0927:Adam7 UTSW 14 68516684 missense probably damaging 1.00
R1172:Adam7 UTSW 14 68514921 missense probably damaging 1.00
R1270:Adam7 UTSW 14 68527669 missense probably damaging 0.98
R1299:Adam7 UTSW 14 68526299 splice site probably benign
R1527:Adam7 UTSW 14 68501521 missense probably benign 0.04
R1543:Adam7 UTSW 14 68521922 splice site probably benign
R1731:Adam7 UTSW 14 68525356 missense probably damaging 1.00
R1732:Adam7 UTSW 14 68498450 missense probably benign 0.00
R1921:Adam7 UTSW 14 68512625 missense possibly damaging 0.55
R2062:Adam7 UTSW 14 68505161 missense probably benign 0.09
R2156:Adam7 UTSW 14 68511343 missense probably benign 0.02
R2697:Adam7 UTSW 14 68514783 nonsense probably null
R4080:Adam7 UTSW 14 68520539 missense probably benign 0.05
R4775:Adam7 UTSW 14 68507912 missense probably benign 0.41
R5202:Adam7 UTSW 14 68507856 missense possibly damaging 0.92
R6006:Adam7 UTSW 14 68511396 missense probably damaging 1.00
R6087:Adam7 UTSW 14 68510757 missense probably damaging 1.00
R6376:Adam7 UTSW 14 68505097 missense possibly damaging 0.78
R6417:Adam7 UTSW 14 68504621 missense probably benign 0.37
R6672:Adam7 UTSW 14 68504702 critical splice acceptor site probably null
R6756:Adam7 UTSW 14 68525279 missense probably benign 0.00
R6777:Adam7 UTSW 14 68525335 missense probably damaging 1.00
R6913:Adam7 UTSW 14 68533651 missense probably benign 0.22
R7127:Adam7 UTSW 14 68514769 critical splice donor site probably null
R7209:Adam7 UTSW 14 68529819 missense probably damaging 1.00
R7399:Adam7 UTSW 14 68504466 intron probably null
R7675:Adam7 UTSW 14 68499853 missense probably benign 0.07
R7788:Adam7 UTSW 14 68512645 missense possibly damaging 0.62
R7868:Adam7 UTSW 14 68532641 missense possibly damaging 0.84
R7951:Adam7 UTSW 14 68532641 missense possibly damaging 0.84
Z1176:Adam7 UTSW 14 68527701 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ACACACAAGTTAAGTGATAGGTAGC -3'
(R):5'- CCTTTAGGGAAGAGATAAAGTTGC -3'

Sequencing Primer
(F):5'- AGGTAGCTTGTACTTTCTATCAGTTC -3'
(R):5'- GCAACTATTGTTAGCAATCCACTGTC -3'
Posted On2014-10-30