Incidental Mutation 'R2353:Parl'
ID246271
Institutional Source Beutler Lab
Gene Symbol Parl
Ensembl Gene ENSMUSG00000033918
Gene Namepresenilin associated, rhomboid-like
SynonymsD16Ertd607e, PSENIP2, PRO2207, PSARL1, Psarl
MMRRC Submission 040335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R2353 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location20279818-20302387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20287040 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 211 (T211A)
Ref Sequence ENSEMBL: ENSMUSP00000155974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048642] [ENSMUST00000133153] [ENSMUST00000136252] [ENSMUST00000152887] [ENSMUST00000232036] [ENSMUST00000232484]
Predicted Effect probably benign
Transcript: ENSMUST00000048642
AA Change: T211A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000045361
Gene: ENSMUSG00000033918
AA Change: T211A

DomainStartEndE-ValueType
transmembrane domain 100 119 N/A INTRINSIC
transmembrane domain 166 185 N/A INTRINSIC
Pfam:Rhomboid 199 351 9.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126001
Predicted Effect probably benign
Transcript: ENSMUST00000133153
Predicted Effect probably benign
Transcript: ENSMUST00000136252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136700
Predicted Effect probably benign
Transcript: ENSMUST00000152887
AA Change: T22A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155832
Predicted Effect probably benign
Transcript: ENSMUST00000231547
Predicted Effect probably benign
Transcript: ENSMUST00000232036
AA Change: T211A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect unknown
Transcript: ENSMUST00000232484
AA Change: N82S
Meta Mutation Damage Score 0.0883 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the rhomboid family of intramembrane serine proteases that is localized to the inner mitochondrial membrane. The encoded protein regulates mitochondrial remodeling and apoptosis through regulated substrate proteolysis. Proteolytic processing of the encoded protein results in the release of a small peptide, P-beta, which may transit to the nucleus. Mutations in this gene may be associated with Parkinson's disease. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mice show stunted growth, lymphocyte and neuron apoptosis, faster apoptotic cristae remodeling and cytochrome c release from mitochondria, dyspnea, cryptorchism, reduced testes and epididymi, kyphosis and premature death due to progressive cachexia sustained by multisystemic atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 G T 4: 144,623,209 E345D probably damaging Het
Adam7 T A 14: 68,505,088 Q692L probably benign Het
AF366264 T A 8: 13,836,951 E380V probably damaging Het
Ankk1 A C 9: 49,418,690 C322G probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Apeh T C 9: 108,086,292 D577G possibly damaging Het
Aspm T A 1: 139,477,697 W1441R probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cd163 G T 6: 124,319,156 E820* probably null Het
Cd38 T A 5: 43,908,011 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Enpp1 C A 10: 24,651,341 Q649H probably benign Het
Garnl3 T A 2: 33,064,034 R86S probably damaging Het
Gbe1 A G 16: 70,437,021 probably null Het
Gm5117 A G 8: 31,739,195 noncoding transcript Het
Hip1 A T 5: 135,412,712 V568E probably damaging Het
Hspa14 G A 2: 3,511,176 probably null Het
Lrrc4 A G 6: 28,831,452 F55L probably benign Het
Med31 T A 11: 72,214,140 N35I probably damaging Het
Msi1 C A 5: 115,436,509 probably benign Het
Olfr1270 A T 2: 90,149,718 L96Q probably damaging Het
Olfr394 T C 11: 73,887,834 I179M probably benign Het
Ppwd1 T C 13: 104,213,582 I432V probably benign Het
Scn10a T A 9: 119,638,687 I796F probably damaging Het
Sh3rf3 A G 10: 59,007,073 D287G probably damaging Het
Sin3b T C 8: 72,724,152 probably null Het
Ubr4 T C 4: 139,433,673 I2493T possibly damaging Het
Uts2 T A 4: 151,000,136 probably null Het
Zfp109 T C 7: 24,229,381 D201G probably benign Het
Zfp407 A G 18: 84,559,880 F1036S probably damaging Het
Znrf3 T C 11: 5,281,170 E685G probably damaging Het
Other mutations in Parl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Parl APN 16 20298208 missense probably damaging 0.99
IGL01013:Parl APN 16 20282790 missense possibly damaging 0.50
IGL02159:Parl APN 16 20280088 splice site probably benign
IGL02189:Parl APN 16 20297703 missense probably damaging 1.00
R0233:Parl UTSW 16 20287907 missense probably damaging 0.96
R1301:Parl UTSW 16 20286926 missense probably damaging 1.00
R1954:Parl UTSW 16 20302327 start codon destroyed possibly damaging 0.95
R1955:Parl UTSW 16 20302327 start codon destroyed possibly damaging 0.95
R3884:Parl UTSW 16 20283012 missense probably damaging 0.98
R5345:Parl UTSW 16 20298142 missense probably damaging 0.99
R5477:Parl UTSW 16 20280074 missense possibly damaging 0.90
R5567:Parl UTSW 16 20283012 missense probably damaging 0.97
R5687:Parl UTSW 16 20287978 intron probably benign
R6238:Parl UTSW 16 20302213 missense possibly damaging 0.94
R7311:Parl UTSW 16 20287875 missense probably benign 0.02
R8028:Parl UTSW 16 20280051 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CCTGAGGATGTGCTGTGTAC -3'
(R):5'- CCTTTGAAATACACTCTGTTAAGCC -3'

Sequencing Primer
(F):5'- GTGTGCAGACTTCTACGATCAAC -3'
(R):5'- ACTCTGTTAAGCCATCTTATTTAAGC -3'
Posted On2014-10-30