Mutagenetix > Incidental Mutation

Incidental Mutation 'R2353:Zfp407'

246274

Institutional Source

Beutler Lab

Gene Symbol

Zfp407

Ensembl Gene

ENSMUSG00000048410

Gene Name

zinc finger protein 407

Synonyms

6430585N13Rik, LOC240469, LOC381139

MMRRC Submission

040335-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2353 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84128027-84589725 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 84559880 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1036 (F1036S)

Ref Sequence

ENSEMBL: ENSMUSP00000118361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000125763]

AlphaFold

G3UVV3

Predicted Effect

probably benign
Transcript: ENSMUST00000125450

Predicted Effect

probably damaging
Transcript: ENSMUST00000125763
AA Change: F1036S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118361
Gene: ENSMUSG00000048410
AA Change: F1036S

Domain	Start	End	E-Value	Type
low complexity region	20	37	N/A	INTRINSIC
ZnF_C2H2	178	200	8.67e-1	SMART
ZnF_U1	233	267	6.79e-1	SMART
ZnF_C2H2	236	260	4.65e-1	SMART
ZnF_C2H2	522	545	7.05e-1	SMART
ZnF_U1	548	582	1.54e1	SMART
ZnF_C2H2	551	575	1.01e-1	SMART
ZnF_C2H2	582	605	1.41e0	SMART
ZnF_U1	606	639	2.22e0	SMART
ZnF_C2H2	609	632	1.01e2	SMART
ZnF_C2H2	695	718	6.23e-2	SMART
ZnF_U1	721	755	2.96e0	SMART
ZnF_C2H2	724	748	7.11e0	SMART
ZnF_C2H2	840	863	7.55e-1	SMART
ZnF_U1	866	900	3.81e-1	SMART
ZnF_C2H2	869	893	1.07e0	SMART
ZnF_C2H2	1009	1032	6.13e-1	SMART
ZnF_U1	1035	1069	2.22e0	SMART
ZnF_C2H2	1038	1062	5.62e0	SMART
low complexity region	1223	1234	N/A	INTRINSIC
ZnF_C2H2	1405	1428	5.92e0	SMART
ZnF_U1	1432	1466	2.35e0	SMART
ZnF_C2H2	1435	1459	1.76e-1	SMART
ZnF_C2H2	1477	1500	5.42e-2	SMART
ZnF_C2H2	1528	1552	1.68e1	SMART
ZnF_C2H2	1558	1580	1.43e-1	SMART
ZnF_C2H2	1586	1609	9.58e-3	SMART
ZnF_C2H2	1619	1641	2.61e-4	SMART
ZnF_C2H2	1647	1671	1.04e-3	SMART
ZnF_C2H2	1677	1699	9.44e-2	SMART
ZnF_C2H2	1705	1727	1.82e-3	SMART
ZnF_C2H2	1733	1758	4.65e-1	SMART
ZnF_C2H2	1764	1787	1.26e-2	SMART
low complexity region	1876	1887	N/A	INTRINSIC
low complexity region	2017	2032	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156181

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182297

Meta Mutation Damage Score

0.2334

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein whose exact function is not known. It may be involved in transcriptional regulation. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	G	T	4: 144,623,209	E345D	probably damaging	Het
Adam7	T	A	14: 68,505,088	Q692L	probably benign	Het
AF366264	T	A	8: 13,836,951	E380V	probably damaging	Het
Ankk1	A	C	9: 49,418,690	C322G	probably benign	Het
Ap3b2	C	T	7: 81,473,850		probably benign	Het
Apeh	T	C	9: 108,086,292	D577G	possibly damaging	Het
Aspm	T	A	1: 139,477,697	W1441R	probably damaging	Het
B4galt3	C	A	1: 171,274,043	H196N	probably damaging	Het
Cd163	G	T	6: 124,319,156	E820*	probably null	Het
Cd38	T	A	5: 43,908,011		probably null	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Enpp1	C	A	10: 24,651,341	Q649H	probably benign	Het
Garnl3	T	A	2: 33,064,034	R86S	probably damaging	Het
Gbe1	A	G	16: 70,437,021		probably null	Het
Gm5117	A	G	8: 31,739,195		noncoding transcript	Het
Hip1	A	T	5: 135,412,712	V568E	probably damaging	Het
Hspa14	G	A	2: 3,511,176		probably null	Het
Lrrc4	A	G	6: 28,831,452	F55L	probably benign	Het
Med31	T	A	11: 72,214,140	N35I	probably damaging	Het
Msi1	C	A	5: 115,436,509		probably benign	Het
Olfr1270	A	T	2: 90,149,718	L96Q	probably damaging	Het
Olfr394	T	C	11: 73,887,834	I179M	probably benign	Het
Parl	T	C	16: 20,287,040	T211A	probably benign	Het
Ppwd1	T	C	13: 104,213,582	I432V	probably benign	Het
Scn10a	T	A	9: 119,638,687	I796F	probably damaging	Het
Sh3rf3	A	G	10: 59,007,073	D287G	probably damaging	Het
Sin3b	T	C	8: 72,724,152		probably null	Het
Ubr4	T	C	4: 139,433,673	I2493T	possibly damaging	Het
Uts2	T	A	4: 151,000,136		probably null	Het
Zfp109	T	C	7: 24,229,381	D201G	probably benign	Het
Znrf3	T	C	11: 5,281,170	E685G	probably damaging	Het

Other mutations in Zfp407

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Zfp407	APN	18	84561752	missense	probably damaging	0.99
IGL02105:Zfp407	APN	18	84562720	nonsense	probably null
IGL02110:Zfp407	APN	18	84559040	missense	probably benign	0.00
IGL02343:Zfp407	APN	18	84209724	missense	possibly damaging	0.71
IGL02456:Zfp407	APN	18	84558641	missense	probably damaging	1.00
IGL02705:Zfp407	APN	18	84559031	nonsense	probably null
IGL02946:Zfp407	APN	18	84560709	missense	probably damaging	1.00
IGL03069:Zfp407	APN	18	84350975	missense	probably damaging	1.00
IGL03145:Zfp407	APN	18	84209721	missense	probably damaging	0.99
IGL03403:Zfp407	APN	18	84560797	missense	probably damaging	1.00
IGL03134:Zfp407	UTSW	18	84209955	missense	probably damaging	0.99
PIT4362001:Zfp407	UTSW	18	84561268	missense	possibly damaging	0.87
PIT4520001:Zfp407	UTSW	18	84432420	missense	probably damaging	0.99
R0087:Zfp407	UTSW	18	84560411	missense	probably damaging	1.00
R0243:Zfp407	UTSW	18	84558711	missense	probably damaging	1.00
R0594:Zfp407	UTSW	18	84562567	missense	possibly damaging	0.87
R0766:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R0787:Zfp407	UTSW	18	84209022	missense	probably damaging	1.00
R0787:Zfp407	UTSW	18	84209346	missense	probably benign	0.00
R1065:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1086:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1165:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1186:Zfp407	UTSW	18	84209448	missense	probably benign	0.39
R1203:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1312:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1345:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1385:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1421:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1430:Zfp407	UTSW	18	84209455	missense	probably benign	0.18
R1436:Zfp407	UTSW	18	84343071	splice site	probably benign
R1498:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1526:Zfp407	UTSW	18	84561033	missense	possibly damaging	0.61
R1579:Zfp407	UTSW	18	84209638	missense	probably benign	0.00
R1594:Zfp407	UTSW	18	84209331	missense	probably benign	0.01
R1628:Zfp407	UTSW	18	84354533	missense	probably damaging	1.00
R1698:Zfp407	UTSW	18	84562157	missense	probably damaging	1.00
R1962:Zfp407	UTSW	18	84559336	missense	probably benign	0.01
R1984:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1985:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R1986:Zfp407	UTSW	18	84559773	missense	probably benign	0.14
R2151:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2152:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2154:Zfp407	UTSW	18	84209649	missense	possibly damaging	0.55
R2259:Zfp407	UTSW	18	84209793	missense	probably damaging	1.00
R2845:Zfp407	UTSW	18	84558397	nonsense	probably null
R3407:Zfp407	UTSW	18	84558872	missense	probably benign	0.08
R3432:Zfp407	UTSW	18	84208746	missense	probably damaging	1.00
R3892:Zfp407	UTSW	18	84560352	missense	probably damaging	1.00
R4026:Zfp407	UTSW	18	84559596	missense	possibly damaging	0.82
R4107:Zfp407	UTSW	18	84343007	missense	possibly damaging	0.82
R4398:Zfp407	UTSW	18	84562731	nonsense	probably null
R4447:Zfp407	UTSW	18	84562694	missense	possibly damaging	0.95
R4752:Zfp407	UTSW	18	84562914	missense	probably benign	0.01
R4881:Zfp407	UTSW	18	84559703	missense	probably benign	0.27
R4936:Zfp407	UTSW	18	84559464	missense	probably benign	0.00
R5194:Zfp407	UTSW	18	84561309	missense	probably benign	0.05
R5243:Zfp407	UTSW	18	84561091	missense	probably damaging	1.00
R5258:Zfp407	UTSW	18	84315926	missense	probably damaging	1.00
R5591:Zfp407	UTSW	18	84561137	missense	probably damaging	1.00
R5633:Zfp407	UTSW	18	84561044	missense	probably benign	0.35
R5739:Zfp407	UTSW	18	84208742	makesense	probably null
R5806:Zfp407	UTSW	18	84558614	missense	probably damaging	1.00
R5820:Zfp407	UTSW	18	84560524	missense	probably benign	0.01
R6187:Zfp407	UTSW	18	84559009	missense	possibly damaging	0.87
R6512:Zfp407	UTSW	18	84560349	missense	probably damaging	1.00
R6521:Zfp407	UTSW	18	84432411	missense	probably damaging	1.00
R6748:Zfp407	UTSW	18	84208830	missense	probably damaging	0.98
R6882:Zfp407	UTSW	18	84343069	splice site	probably null
R6899:Zfp407	UTSW	18	84561434	missense	possibly damaging	0.86
R7038:Zfp407	UTSW	18	84561857	missense	probably damaging	1.00
R7076:Zfp407	UTSW	18	84558476	missense	probably damaging	1.00
R7326:Zfp407	UTSW	18	84559042	missense	possibly damaging	0.77
R7397:Zfp407	UTSW	18	84561819	missense	possibly damaging	0.59
R7402:Zfp407	UTSW	18	84561536	missense	probably benign	0.02
R7783:Zfp407	UTSW	18	84209922	missense	possibly damaging	0.69
R7800:Zfp407	UTSW	18	84560675	missense	probably damaging	0.99
R7904:Zfp407	UTSW	18	84561256	missense	not run
R7942:Zfp407	UTSW	18	84559629	missense	probably benign	0.02
R7955:Zfp407	UTSW	18	84559291	missense	probably benign	0.02
R7988:Zfp407	UTSW	18	84559400	missense	possibly damaging	0.60
R8125:Zfp407	UTSW	18	84561185	missense	probably damaging	1.00
R8237:Zfp407	UTSW	18	84560144	missense	possibly damaging	0.87
R8364:Zfp407	UTSW	18	84552868	critical splice donor site	probably null
R8443:Zfp407	UTSW	18	84209862	missense	probably damaging	1.00
R8487:Zfp407	UTSW	18	84562770	nonsense	probably null
R8497:Zfp407	UTSW	18	84559896	missense	probably damaging	0.98
R8808:Zfp407	UTSW	18	84343060	missense	probably benign	0.17
R8848:Zfp407	UTSW	18	84560694	missense	probably damaging	1.00
R8913:Zfp407	UTSW	18	84560528	missense	probably damaging	0.99
R8962:Zfp407	UTSW	18	84558932	missense	probably damaging	1.00
R9087:Zfp407	UTSW	18	84209857	missense	probably damaging	0.96
R9452:Zfp407	UTSW	18	84562454	missense	probably benign	0.02
R9691:Zfp407	UTSW	18	84560187	missense	probably benign	0.03
R9766:Zfp407	UTSW	18	84559449	missense	probably benign	0.06
RF003:Zfp407	UTSW	18	84209563	missense	probably benign	0.17
Z1177:Zfp407	UTSW	18	84209954	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ATGCTCCTCCTCGGGTATAG -3'
(R):5'- CTGAAGCTGGGAGTGTATTTCC -3'

Sequencing Primer
(F):5'- CTCCTCCTCGGGTATAGTGATG -3'
(R):5'- GAGAGCTTAGCAGTCAACTCTCTG -3'

Posted On

2014-10-30