Incidental Mutation 'R2365:Slc40a1'
ID246275
Institutional Source Beutler Lab
Gene Symbol Slc40a1
Ensembl Gene ENSMUSG00000025993
Gene Namesolute carrier family 40 (iron-regulated transporter), member 1
SynonymsDusg, metal transporting protein 1, Ol5, ferroportin1, IREG1, Slc11a3, FPN1, Pcm, MTP1
MMRRC Submission 040346-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2365 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location45908068-45926523 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 45924713 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027137] [ENSMUST00000186804] [ENSMUST00000186804] [ENSMUST00000187406] [ENSMUST00000187406] [ENSMUST00000187420] [ENSMUST00000187420]
Predicted Effect probably null
Transcript: ENSMUST00000027137
SMART Domains Protein: ENSMUSP00000027137
Gene: ENSMUSG00000025993

DomainStartEndE-ValueType
Pfam:FPN1 22 530 5e-194 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186755
Predicted Effect probably null
Transcript: ENSMUST00000186804
SMART Domains Protein: ENSMUSP00000140969
Gene: ENSMUSG00000025993

DomainStartEndE-ValueType
Pfam:FPN1 22 70 4.9e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000186804
SMART Domains Protein: ENSMUSP00000140969
Gene: ENSMUSG00000025993

DomainStartEndE-ValueType
Pfam:FPN1 22 70 4.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186822
Predicted Effect probably null
Transcript: ENSMUST00000187406
SMART Domains Protein: ENSMUSP00000140734
Gene: ENSMUSG00000025993

DomainStartEndE-ValueType
Pfam:FPN1 22 70 4.9e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000187406
SMART Domains Protein: ENSMUSP00000140734
Gene: ENSMUSG00000025993

DomainStartEndE-ValueType
Pfam:FPN1 22 70 4.9e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000187420
SMART Domains Protein: ENSMUSP00000140549
Gene: ENSMUSG00000025993

DomainStartEndE-ValueType
Pfam:FPN1 22 70 4.9e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000187420
SMART Domains Protein: ENSMUSP00000140549
Gene: ENSMUSG00000025993

DomainStartEndE-ValueType
Pfam:FPN1 22 70 4.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191247
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell membrane protein that may be involved in iron export from duodenal epithelial cells. Defects in this gene are a cause of hemochromatosis type 4 (HFE4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit embryonic lethality before embryo turning. Mice heterozygous for a targeted mutation display decreased thermal response latency. Mice heterozygous for an ENU induced mutation display abnormal iron homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 T A 16: 29,251,256 K959N probably benign Het
C4b G A 17: 34,736,058 probably benign Het
Cdhr2 T G 13: 54,718,088 S268R probably benign Het
Erc1 A G 6: 119,575,695 L1094P probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fat4 A G 3: 38,980,419 H2740R probably benign Het
Galnt13 A G 2: 54,854,697 Y136C possibly damaging Het
Gipc2 A G 3: 152,128,194 I150T possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm21957 T C 7: 125,219,457 noncoding transcript Het
Gm5591 T A 7: 38,519,401 R683W probably damaging Het
Gm826 A G 2: 160,327,210 S60P unknown Het
Hsd17b7 T C 1: 169,964,440 D133G probably damaging Het
Kera A G 10: 97,608,943 T55A probably benign Het
Mff T C 1: 82,735,471 V129A possibly damaging Het
Myo7b A G 18: 32,014,331 L53P probably damaging Het
Neo1 A G 9: 58,956,003 V427A probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr596 A T 7: 103,310,173 I151L probably benign Het
Pfkfb3 C T 2: 11,493,902 probably null Het
Pom121l2 A G 13: 21,983,784 T742A probably benign Het
Pon1 A G 6: 5,171,746 S302P probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Sall3 G C 18: 80,971,792 P974A probably benign Het
Slc1a2 T A 2: 102,748,453 probably null Het
Slc22a6 A G 19: 8,619,397 T180A probably benign Het
Slc6a5 T C 7: 49,946,536 S585P possibly damaging Het
Tbpl1 A G 10: 22,705,886 V164A possibly damaging Het
Tmem98 A T 11: 80,815,685 I95F probably damaging Het
Ush2a C A 1: 188,378,991 P571T possibly damaging Het
Vars A G 17: 35,015,452 N1125D probably benign Het
Vps13d T C 4: 145,087,324 probably benign Het
Zbtb18 A T 1: 177,448,157 E361V probably benign Het
Zc3hav1 A G 6: 38,340,233 F144S probably damaging Het
Other mutations in Slc40a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Slc40a1 APN 1 45909492 missense probably benign 0.19
IGL01576:Slc40a1 APN 1 45909597 missense probably damaging 1.00
IGL02113:Slc40a1 APN 1 45910894 missense probably benign 0.33
IGL02116:Slc40a1 APN 1 45911528 missense probably benign 0.01
IGL02220:Slc40a1 APN 1 45911335 missense probably damaging 1.00
IGL02537:Slc40a1 APN 1 45911393 missense probably benign 0.01
IGL02574:Slc40a1 APN 1 45912374 missense possibly damaging 0.77
IGL02673:Slc40a1 APN 1 45918416 missense possibly damaging 0.82
IGL02794:Slc40a1 APN 1 45909508 nonsense probably null
R0376:Slc40a1 UTSW 1 45912491 splice site probably benign
R0417:Slc40a1 UTSW 1 45911374 missense possibly damaging 0.50
R1608:Slc40a1 UTSW 1 45911297 missense probably damaging 0.96
R1723:Slc40a1 UTSW 1 45924761 missense probably damaging 1.00
R1892:Slc40a1 UTSW 1 45911142 nonsense probably null
R2092:Slc40a1 UTSW 1 45909454 missense probably benign
R2303:Slc40a1 UTSW 1 45910884 splice site probably benign
R3718:Slc40a1 UTSW 1 45910991 missense probably benign
R4689:Slc40a1 UTSW 1 45912313 missense probably benign 0.00
R4994:Slc40a1 UTSW 1 45909664 missense probably damaging 1.00
R5103:Slc40a1 UTSW 1 45918995 nonsense probably null
R5151:Slc40a1 UTSW 1 45911356 missense possibly damaging 0.84
R5364:Slc40a1 UTSW 1 45925223 missense probably damaging 0.96
R5404:Slc40a1 UTSW 1 45912328 missense probably damaging 1.00
R5531:Slc40a1 UTSW 1 45912338 missense probably damaging 1.00
R5841:Slc40a1 UTSW 1 45912349 missense probably damaging 1.00
R6440:Slc40a1 UTSW 1 45925262 start codon destroyed probably null 0.94
R6455:Slc40a1 UTSW 1 45918947 missense probably damaging 0.99
R6975:Slc40a1 UTSW 1 45909492 missense probably benign 0.19
R7085:Slc40a1 UTSW 1 45911528 missense probably benign
R7130:Slc40a1 UTSW 1 45921224 missense probably damaging 1.00
R7502:Slc40a1 UTSW 1 45918974 missense probably damaging 1.00
R7755:Slc40a1 UTSW 1 45911306 missense probably damaging 0.99
R8085:Slc40a1 UTSW 1 45918368 missense probably damaging 1.00
R8218:Slc40a1 UTSW 1 45910969 missense probably benign 0.03
R8308:Slc40a1 UTSW 1 45911020 missense probably benign 0.02
R8333:Slc40a1 UTSW 1 45911279 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CACTCATGGGAAACATCTTTGAAG -3'
(R):5'- ACGCTGAATCTTAAGTGGATGC -3'

Sequencing Primer
(F):5'- CATGGGAAACATCTTTGAAGAAAAC -3'
(R):5'- TGCATCAGTCTTGTAAGTGACC -3'
Posted On2014-10-30