Incidental Mutation 'R2365:Gm826'
ID246283
Institutional Source Beutler Lab
Gene Symbol Gm826
Ensembl Gene ENSMUSG00000074623
Gene Namepredicted gene 826
SynonymsLOC329554
MMRRC Submission 040346-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2365 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location160311393-160334162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 160327210 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 60 (S60P)
Ref Sequence ENSEMBL: ENSMUSP00000096729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099127]
Predicted Effect unknown
Transcript: ENSMUST00000099127
AA Change: S60P
SMART Domains Protein: ENSMUSP00000096729
Gene: ENSMUSG00000074623
AA Change: S60P

DomainStartEndE-ValueType
low complexity region 72 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138905
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 94% (34/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 T A 16: 29,251,256 K959N probably benign Het
C4b G A 17: 34,736,058 probably benign Het
Cdhr2 T G 13: 54,718,088 S268R probably benign Het
Erc1 A G 6: 119,575,695 L1094P probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fat4 A G 3: 38,980,419 H2740R probably benign Het
Galnt13 A G 2: 54,854,697 Y136C possibly damaging Het
Gipc2 A G 3: 152,128,194 I150T possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm21957 T C 7: 125,219,457 noncoding transcript Het
Gm5591 T A 7: 38,519,401 R683W probably damaging Het
Hsd17b7 T C 1: 169,964,440 D133G probably damaging Het
Kera A G 10: 97,608,943 T55A probably benign Het
Mff T C 1: 82,735,471 V129A possibly damaging Het
Myo7b A G 18: 32,014,331 L53P probably damaging Het
Neo1 A G 9: 58,956,003 V427A probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr596 A T 7: 103,310,173 I151L probably benign Het
Pfkfb3 C T 2: 11,493,902 probably null Het
Pom121l2 A G 13: 21,983,784 T742A probably benign Het
Pon1 A G 6: 5,171,746 S302P probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Sall3 G C 18: 80,971,792 P974A probably benign Het
Slc1a2 T A 2: 102,748,453 probably null Het
Slc22a6 A G 19: 8,619,397 T180A probably benign Het
Slc40a1 T C 1: 45,924,713 probably null Het
Slc6a5 T C 7: 49,946,536 S585P possibly damaging Het
Tbpl1 A G 10: 22,705,886 V164A possibly damaging Het
Tmem98 A T 11: 80,815,685 I95F probably damaging Het
Ush2a C A 1: 188,378,991 P571T possibly damaging Het
Vars A G 17: 35,015,452 N1125D probably benign Het
Vps13d T C 4: 145,087,324 probably benign Het
Zbtb18 A T 1: 177,448,157 E361V probably benign Het
Zc3hav1 A G 6: 38,340,233 F144S probably damaging Het
Other mutations in Gm826
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03182:Gm826 APN 2 160327115 missense unknown
R3762:Gm826 UTSW 2 160313503 intron probably benign
R3769:Gm826 UTSW 2 160327245 missense unknown
R4564:Gm826 UTSW 2 160311993 utr 3 prime probably benign
R6125:Gm826 UTSW 2 160327114 missense unknown
R6442:Gm826 UTSW 2 160327408 start gained probably benign
R7048:Gm826 UTSW 2 160327106 nonsense probably null
R7074:Gm826 UTSW 2 160311890 missense unknown
R7491:Gm826 UTSW 2 160312022 missense unknown
R7883:Gm826 UTSW 2 160327293 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTTTCACACTGAACATAGTCACAC -3'
(R):5'- TGGAAGTCTCTTTGCCTTCAGC -3'

Sequencing Primer
(F):5'- TGAACATAGTCACACAAACATGTCTG -3'
(R):5'- TTCAGCAGCCCCGCTCAG -3'
Posted On2014-10-30