Mutagenetix > Incidental Mutations

Incidental Mutation 'R0284:Exoc2'

24629

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

MMRRC Submission

038505-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R0284 (G1)

Quality Score

190

Status

Validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 30877625 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000100010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

Predicted Effect

probably benign
Transcript: ENSMUST00000021785

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102946

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.9%
20x: 92.4%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	T	G	4: 41,507,538	E150A	probably damaging	Het
Akap2	T	C	4: 57,855,207	F220L	probably damaging	Het
Alkbh6	A	G	7: 30,313,988	T161A	probably benign	Het
Alox12e	A	G	11: 70,320,899		probably benign	Het
Ap1g2	A	G	14: 55,101,692		probably benign	Het
Arid2	A	T	15: 96,378,967		probably benign	Het
Bmp2k	A	T	5: 97,068,455	H604L	unknown	Het
Cacna1a	A	T	8: 84,612,285	M1705L	probably damaging	Het
Cacna1d	A	T	14: 30,072,105	D1526E	probably damaging	Het
Ccdc171	A	G	4: 83,549,738	R107G	possibly damaging	Het
Cklf	T	C	8: 104,261,575		probably benign	Het
Crabp1	A	G	9: 54,764,926	K9E	probably benign	Het
Cspg4	A	G	9: 56,886,139	D386G	probably damaging	Het
Cyp3a41b	G	A	5: 145,578,204		probably benign	Het
Dsg1a	T	A	18: 20,331,627	V393E	probably damaging	Het
Ednrb	C	T	14: 103,820,013	G371D	probably damaging	Het
Efcab5	T	C	11: 77,103,527		probably benign	Het
Fbn2	G	A	18: 58,050,290		probably benign	Het
Foxo6	T	C	4: 120,269,002	S199G	probably benign	Het
Fpr1	T	A	17: 17,877,356	I124F	probably damaging	Het
Gk5	A	T	9: 96,181,770		probably null	Het
Gys1	A	T	7: 45,436,719		probably benign	Het
Igfbp1	T	C	11: 7,198,103	S49P	probably damaging	Het
Incenp	A	T	19: 9,893,993	S91T	unknown	Het
Itpkc	G	A	7: 27,214,543	R498*	probably null	Het
Kat6a	A	G	8: 22,939,803	T1725A	unknown	Het
Kiz	T	A	2: 146,863,810	C97S	probably benign	Het
Kri1	A	G	9: 21,276,552		probably benign	Het
Lipn	A	G	19: 34,080,706	S276G	possibly damaging	Het
Llgl1	A	G	11: 60,712,141	T881A	probably damaging	Het
Man1a2	T	C	3: 100,684,786	H26R	probably damaging	Het
Map3k5	T	A	10: 20,000,613	F173I	probably damaging	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Mipol1	A	G	12: 57,457,069	Q341R	probably damaging	Het
Mllt6	G	T	11: 97,678,605	A928S	probably benign	Het
Ncoa6	TGC	TGCGC	2: 155,408,291		probably null	Het
Nipsnap3a	C	T	4: 52,997,178	T150I	probably benign	Het
Nsl1	A	G	1: 191,065,230	E97G	probably damaging	Het
Olfr1278	T	C	2: 111,292,586	V106A	probably benign	Het
Olfr251	G	A	9: 38,378,584	M234I	probably benign	Het
Olfr736	G	A	14: 50,392,995	V80M	probably damaging	Het
Olfr830	A	T	9: 18,875,552	Y72F	probably benign	Het
Pdcd6ip	A	G	9: 113,662,504	L552S	probably damaging	Het
Plekhf2	T	C	4: 10,990,595		probably benign	Het
Prdm1	T	C	10: 44,456,626	E96G	probably damaging	Het
Prpf40a	T	A	2: 53,150,647	E608D	probably damaging	Het
Prpf40b	A	T	15: 99,316,393		probably benign	Het
Rag2	T	C	2: 101,630,119	V258A	probably damaging	Het
S100a5	A	G	3: 90,611,574	I68V	probably benign	Het
Serpinb8	G	A	1: 107,602,918		probably null	Het
Slc24a4	T	C	12: 102,260,481	V492A	probably damaging	Het
Spag6l	T	A	16: 16,780,766	Q287L	probably damaging	Het
Synpo2	C	T	3: 123,079,734	W211*	probably null	Het
Tgtp1	A	G	11: 48,987,143	V245A	probably benign	Het
Tmem144	G	A	3: 79,839,273		probably benign	Het
Trerf1	A	G	17: 47,319,545		noncoding transcript	Het
Ttn	G	C	2: 76,846,704		probably benign	Het
Vmn1r28	G	A	6: 58,265,717	A182T	probably benign	Het
Vps13d	A	T	4: 145,144,802	M1900K	probably benign	Het
Vps41	A	T	13: 18,853,440	D691V	probably damaging	Het
Zfp518b	T	C	5: 38,671,740	Y974C	probably damaging	Het
Zscan29	A	T	2: 121,166,733		probably benign	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1501:Exoc2	UTSW	13	30935502	missense	probably benign	0.01
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5410:Exoc2	UTSW	13	30864856	missense	probably damaging	0.98
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R5956:Exoc2	UTSW	13	30820623	missense	probably benign	0.03
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6692:Exoc2	UTSW	13	30935507	missense	probably benign	0.09
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7386:Exoc2	UTSW	13	30906663	splice site	probably null
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7473:Exoc2	UTSW	13	30822630	critical splice donor site	probably null
R7613:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7793:Exoc2	UTSW	13	30911178	missense	probably benign	0.00
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R7993:Exoc2	UTSW	13	30906730	critical splice donor site	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8716:Exoc2	UTSW	13	30911244	missense	probably damaging	1.00
R8735:Exoc2	UTSW	13	30906839	missense	probably damaging	1.00
R8922:Exoc2	UTSW	13	30871855	missense	probably benign	0.05
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9243:Exoc2	UTSW	13	30925795	missense	probably benign	0.03
R9365:Exoc2	UTSW	13	30856714	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CATGTAAACCCACTGAGCCCTTTCC -3'
(R):5'- TGTGCCTCGATTTGTAGCAGAGC -3'

Sequencing Primer
(F):5'- ATCAGCTTCACCAGGGAGTG -3'
(R):5'- CTCGATTTGTAGCAGAGCTTAGAAAG -3'

Posted On

2013-04-16