Incidental Mutation 'R2365:Erc1'
ID246292
Institutional Source Beutler Lab
Gene Symbol Erc1
Ensembl Gene ENSMUSG00000030172
Gene NameELKS/RAB6-interacting/CAST family member 1
SynonymsB430107L16Rik, Rab6ip2, 5033405M01Rik, RAB6IP2A, 9630025C19Rik, RAB6IP2B
MMRRC Submission 040346-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2365 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location119570796-119848167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119575695 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1094 (L1094P)
Ref Sequence ENSEMBL: ENSMUSP00000139256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032279] [ENSMUST00000183703] [ENSMUST00000183880] [ENSMUST00000183911] [ENSMUST00000184838] [ENSMUST00000184864] [ENSMUST00000185139] [ENSMUST00000185143]
Predicted Effect probably damaging
Transcript: ENSMUST00000032279
AA Change: L1098P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032279
Gene: ENSMUSG00000030172
AA Change: L1098P

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 466 1.8e-142 PFAM
Pfam:Cast 453 838 3.5e-163 PFAM
Pfam:Cast 833 986 8e-61 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183703
AA Change: L1098P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139031
Gene: ENSMUSG00000030172
AA Change: L1098P

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 986 6.9e-291 PFAM
Pfam:RBD-FIP 1072 1112 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183880
SMART Domains Protein: ENSMUSP00000138823
Gene: ENSMUSG00000030172

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 914 4.3e-296 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183911
AA Change: L1066P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139118
Gene: ENSMUSG00000030172
AA Change: L1066P

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 954 4.2e-293 PFAM
Pfam:RBD-FIP 1040 1080 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184320
Predicted Effect probably benign
Transcript: ENSMUST00000184838
SMART Domains Protein: ENSMUSP00000139030
Gene: ENSMUSG00000030172

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 942 3.5e-291 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184864
AA Change: L1094P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139256
Gene: ENSMUSG00000030172
AA Change: L1094P

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 982 2e-288 PFAM
Pfam:RBD-FIP 1068 1108 8.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185139
SMART Domains Protein: ENSMUSP00000139152
Gene: ENSMUSG00000030172

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 958 3.6e-295 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185143
SMART Domains Protein: ENSMUSP00000138989
Gene: ENSMUSG00000030172

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
low complexity region 35 51 N/A INTRINSIC
Pfam:Cast 154 224 1.7e-28 PFAM
Pfam:Cast 222 686 8e-145 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204314
Meta Mutation Damage Score 0.6340 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. This gene has been found fused to the receptor-type tyrosine kinase gene RET by gene rearrangement due to the translocation t(10;12)(q11;p13) in thyroid papillary carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for null mutations in this gene display embryonic lethality. Mice heterozygous for a gene trap null allele exhibit increased sensitivity to ionizing radiation-induced lethality, with males being more affected than females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 T A 16: 29,251,256 K959N probably benign Het
C4b G A 17: 34,736,058 probably benign Het
Cdhr2 T G 13: 54,718,088 S268R probably benign Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fat4 A G 3: 38,980,419 H2740R probably benign Het
Galnt13 A G 2: 54,854,697 Y136C possibly damaging Het
Gipc2 A G 3: 152,128,194 I150T possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm21957 T C 7: 125,219,457 noncoding transcript Het
Gm5591 T A 7: 38,519,401 R683W probably damaging Het
Gm826 A G 2: 160,327,210 S60P unknown Het
Hsd17b7 T C 1: 169,964,440 D133G probably damaging Het
Kera A G 10: 97,608,943 T55A probably benign Het
Mff T C 1: 82,735,471 V129A possibly damaging Het
Myo7b A G 18: 32,014,331 L53P probably damaging Het
Neo1 A G 9: 58,956,003 V427A probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr596 A T 7: 103,310,173 I151L probably benign Het
Pfkfb3 C T 2: 11,493,902 probably null Het
Pom121l2 A G 13: 21,983,784 T742A probably benign Het
Pon1 A G 6: 5,171,746 S302P probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Sall3 G C 18: 80,971,792 P974A probably benign Het
Slc1a2 T A 2: 102,748,453 probably null Het
Slc22a6 A G 19: 8,619,397 T180A probably benign Het
Slc40a1 T C 1: 45,924,713 probably null Het
Slc6a5 T C 7: 49,946,536 S585P possibly damaging Het
Tbpl1 A G 10: 22,705,886 V164A possibly damaging Het
Tmem98 A T 11: 80,815,685 I95F probably damaging Het
Ush2a C A 1: 188,378,991 P571T possibly damaging Het
Vars A G 17: 35,015,452 N1125D probably benign Het
Vps13d T C 4: 145,087,324 probably benign Het
Zbtb18 A T 1: 177,448,157 E361V probably benign Het
Zc3hav1 A G 6: 38,340,233 F144S probably damaging Het
Other mutations in Erc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Erc1 APN 6 119722303 missense probably damaging 0.96
IGL01345:Erc1 APN 6 119761263 nonsense probably null
IGL01370:Erc1 APN 6 119824465 missense probably damaging 1.00
IGL01443:Erc1 APN 6 119824471 missense probably damaging 1.00
IGL01550:Erc1 APN 6 119783394 missense probably damaging 0.96
IGL01798:Erc1 APN 6 119620337 missense possibly damaging 0.86
IGL02032:Erc1 APN 6 119630609 missense probably damaging 1.00
IGL02239:Erc1 APN 6 119773891 missense probably damaging 0.96
IGL02341:Erc1 APN 6 119594973 missense possibly damaging 0.92
couch UTSW 6 119743429 missense possibly damaging 0.81
divan UTSW 6 119753288 missense probably benign 0.27
PIT4498001:Erc1 UTSW 6 119779491 missense possibly damaging 0.92
R0149:Erc1 UTSW 6 119824830 missense probably damaging 1.00
R0277:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R0323:Erc1 UTSW 6 119620328 missense probably damaging 1.00
R1053:Erc1 UTSW 6 119796926 missense probably damaging 1.00
R1252:Erc1 UTSW 6 119743392 missense possibly damaging 0.84
R1355:Erc1 UTSW 6 119743420 nonsense probably null
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1470:Erc1 UTSW 6 119694602 missense probably damaging 1.00
R1680:Erc1 UTSW 6 119575761 missense probably damaging 1.00
R1833:Erc1 UTSW 6 119743429 missense possibly damaging 0.81
R1954:Erc1 UTSW 6 119797305 missense probably damaging 1.00
R2037:Erc1 UTSW 6 119722255 missense possibly damaging 0.94
R3751:Erc1 UTSW 6 119824960 missense probably damaging 0.99
R4473:Erc1 UTSW 6 119848456 splice site probably null
R4778:Erc1 UTSW 6 119797337 splice site probably null
R4897:Erc1 UTSW 6 119777986 critical splice donor site probably null
R5260:Erc1 UTSW 6 119761159 missense probably damaging 1.00
R5382:Erc1 UTSW 6 119761272 missense probably benign 0.02
R5405:Erc1 UTSW 6 119824944 missense probably damaging 1.00
R5801:Erc1 UTSW 6 119773822 missense probably damaging 0.99
R6341:Erc1 UTSW 6 119777998 missense possibly damaging 0.94
R6588:Erc1 UTSW 6 119575726 missense possibly damaging 0.92
R7441:Erc1 UTSW 6 119824951 missense possibly damaging 0.86
R7486:Erc1 UTSW 6 119594946 nonsense probably null
R7532:Erc1 UTSW 6 119779631 missense probably benign 0.02
R7575:Erc1 UTSW 6 119824760 missense possibly damaging 0.93
R7576:Erc1 UTSW 6 119824760 missense possibly damaging 0.93
R7705:Erc1 UTSW 6 119824603 missense probably benign 0.33
R7740:Erc1 UTSW 6 119761188 missense probably benign 0.02
R7789:Erc1 UTSW 6 119773709 nonsense probably null
R7805:Erc1 UTSW 6 119713771 missense possibly damaging 0.85
R7833:Erc1 UTSW 6 119824486 nonsense probably null
R8039:Erc1 UTSW 6 119773665 nonsense probably null
R8229:Erc1 UTSW 6 119753288 missense probably benign 0.27
R8363:Erc1 UTSW 6 119753299 missense probably benign 0.00
R8794:Erc1 UTSW 6 119630655 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGCAGGCAACATTCAAAGC -3'
(R):5'- TGATACAGGGACATCAACTCTG -3'

Sequencing Primer
(F):5'- GTACGATGACAGACACCGACG -3'
(R):5'- ATACAGGGACATCAACTCTGCTTGTC -3'
Posted On2014-10-30