Incidental Mutation 'R2365:Neo1'
ID246298
Institutional Source Beutler Lab
Gene Symbol Neo1
Ensembl Gene ENSMUSG00000032340
Gene Nameneogenin
Synonyms2610028H22Rik, D930014N22Rik, Igdcc2
MMRRC Submission 040346-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2365 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58874687-59036441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58956003 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 427 (V427A)
Ref Sequence ENSEMBL: ENSMUSP00000150600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068664] [ENSMUST00000214547]
Predicted Effect probably benign
Transcript: ENSMUST00000068664
AA Change: V427A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000063656
Gene: ENSMUSG00000032340
AA Change: V427A

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
IGc2 76 147 9.49e-5 SMART
IGc2 175 239 4.43e-5 SMART
IGc2 272 338 6.15e-13 SMART
IGc2 364 428 7.76e-10 SMART
low complexity region 446 458 N/A INTRINSIC
FN3 470 553 8.23e-12 SMART
FN3 570 649 1.78e-16 SMART
FN3 665 749 1.54e-11 SMART
FN3 770 849 5.27e-10 SMART
FN3 885 970 7.63e-7 SMART
FN3 986 1072 2.78e-9 SMART
transmembrane domain 1136 1158 N/A INTRINSIC
Pfam:Neogenin_C 1189 1492 1.9e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214547
AA Change: V427A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215026
Predicted Effect unknown
Transcript: ENSMUST00000216964
AA Change: V174A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217545
Meta Mutation Damage Score 0.1113 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface protein that is a member of the immunoglobulin superfamily. The encoded protein consists of four N-terminal immunoglobulin-like domains, six fibronectin type III domains, a transmembrane domain and a C-terminal internal domain that shares homology with the tumor suppressor candidate gene DCC. This protein may be involved in cell growth and differentiation and in cell-cell adhesion. Defects in this gene are associated with cell proliferation in certain cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display perinatal lethality and abnormal trigeminal nerve development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 T A 16: 29,251,256 K959N probably benign Het
C4b G A 17: 34,736,058 probably benign Het
Cdhr2 T G 13: 54,718,088 S268R probably benign Het
Erc1 A G 6: 119,575,695 L1094P probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fat4 A G 3: 38,980,419 H2740R probably benign Het
Galnt13 A G 2: 54,854,697 Y136C possibly damaging Het
Gipc2 A G 3: 152,128,194 I150T possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm21957 T C 7: 125,219,457 noncoding transcript Het
Gm5591 T A 7: 38,519,401 R683W probably damaging Het
Gm826 A G 2: 160,327,210 S60P unknown Het
Hsd17b7 T C 1: 169,964,440 D133G probably damaging Het
Kera A G 10: 97,608,943 T55A probably benign Het
Mff T C 1: 82,735,471 V129A possibly damaging Het
Myo7b A G 18: 32,014,331 L53P probably damaging Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr596 A T 7: 103,310,173 I151L probably benign Het
Pfkfb3 C T 2: 11,493,902 probably null Het
Pom121l2 A G 13: 21,983,784 T742A probably benign Het
Pon1 A G 6: 5,171,746 S302P probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Sall3 G C 18: 80,971,792 P974A probably benign Het
Slc1a2 T A 2: 102,748,453 probably null Het
Slc22a6 A G 19: 8,619,397 T180A probably benign Het
Slc40a1 T C 1: 45,924,713 probably null Het
Slc6a5 T C 7: 49,946,536 S585P possibly damaging Het
Tbpl1 A G 10: 22,705,886 V164A possibly damaging Het
Tmem98 A T 11: 80,815,685 I95F probably damaging Het
Ush2a C A 1: 188,378,991 P571T possibly damaging Het
Vars A G 17: 35,015,452 N1125D probably benign Het
Vps13d T C 4: 145,087,324 probably benign Het
Zbtb18 A T 1: 177,448,157 E361V probably benign Het
Zc3hav1 A G 6: 38,340,233 F144S probably damaging Het
Other mutations in Neo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Neo1 APN 9 58921919 splice site probably benign
IGL00885:Neo1 APN 9 58888463 missense probably damaging 1.00
IGL01103:Neo1 APN 9 58880799 missense possibly damaging 0.60
IGL01322:Neo1 APN 9 58907085 missense possibly damaging 0.68
IGL02216:Neo1 APN 9 58917053 missense probably damaging 0.96
IGL02327:Neo1 APN 9 58903088 missense probably benign 0.08
IGL02392:Neo1 APN 9 58925811 missense possibly damaging 0.49
IGL02458:Neo1 APN 9 58893867 splice site probably benign
IGL03057:Neo1 APN 9 58878059 missense probably damaging 1.00
IGL03091:Neo1 APN 9 58978668 missense probably damaging 0.98
IGL03193:Neo1 APN 9 58908484 missense probably damaging 1.00
R0097:Neo1 UTSW 9 58882021 intron probably benign
R0419:Neo1 UTSW 9 58990180 splice site probably benign
R0571:Neo1 UTSW 9 58985786 missense probably benign
R0646:Neo1 UTSW 9 58931034 missense probably damaging 1.00
R0736:Neo1 UTSW 9 58917081 missense possibly damaging 0.78
R0739:Neo1 UTSW 9 58921877 missense probably benign 0.22
R1636:Neo1 UTSW 9 58913277 missense probably damaging 1.00
R1694:Neo1 UTSW 9 58880603 missense probably damaging 1.00
R1827:Neo1 UTSW 9 58917031 nonsense probably null
R1927:Neo1 UTSW 9 58990385 missense probably benign 0.12
R2354:Neo1 UTSW 9 58985634 missense probably benign
R3156:Neo1 UTSW 9 58888979 splice site probably null
R3552:Neo1 UTSW 9 58893878 missense probably damaging 1.00
R3829:Neo1 UTSW 9 58913169 missense possibly damaging 0.58
R4477:Neo1 UTSW 9 58877299 missense probably damaging 0.99
R4613:Neo1 UTSW 9 58889041 missense possibly damaging 0.94
R5023:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5046:Neo1 UTSW 9 58893911 missense possibly damaging 0.77
R5057:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5323:Neo1 UTSW 9 58906648 critical splice donor site probably null
R5394:Neo1 UTSW 9 58990234 missense probably benign 0.10
R5470:Neo1 UTSW 9 58931067 missense probably damaging 1.00
R5473:Neo1 UTSW 9 58880843 missense possibly damaging 0.88
R5500:Neo1 UTSW 9 58917054 missense possibly damaging 0.94
R5503:Neo1 UTSW 9 58985650 missense possibly damaging 0.67
R6122:Neo1 UTSW 9 58917008 missense probably benign
R6191:Neo1 UTSW 9 58889029 missense probably damaging 1.00
R6431:Neo1 UTSW 9 58907071 missense probably benign 0.27
R6560:Neo1 UTSW 9 58880601 missense possibly damaging 0.95
R6658:Neo1 UTSW 9 58921849 missense probably benign 0.14
R6772:Neo1 UTSW 9 58902976 missense probably damaging 1.00
R6912:Neo1 UTSW 9 58917052 missense probably benign 0.00
R7061:Neo1 UTSW 9 58990441 missense possibly damaging 0.95
R7145:Neo1 UTSW 9 58889179 missense probably damaging 1.00
R7156:Neo1 UTSW 9 58902923 missense probably damaging 1.00
R7485:Neo1 UTSW 9 58884543 missense probably benign 0.04
R7519:Neo1 UTSW 9 58878065 missense probably benign 0.13
R7615:Neo1 UTSW 9 58884503 missense probably benign 0.07
R7665:Neo1 UTSW 9 58925795 missense probably damaging 1.00
R7695:Neo1 UTSW 9 58902929 missense possibly damaging 0.81
R7753:Neo1 UTSW 9 58956005 missense probably benign 0.00
R7807:Neo1 UTSW 9 58990494 missense probably benign 0.01
X0063:Neo1 UTSW 9 58990298 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATTTAGACTGCTGCTCTTTCG -3'
(R):5'- GGGAGTGTTTCTAAAATGCATAATCTC -3'

Sequencing Primer
(F):5'- CGCTTGTAGTTGTGTCACAGGC -3'
(R):5'- CCAATCTGTTGTGATTAAATTAGC -3'
Posted On2014-10-30