Incidental Mutation 'R2366:F3'
ID246323
Institutional Source Beutler Lab
Gene Symbol F3
Ensembl Gene ENSMUSG00000028128
Gene Namecoagulation factor III
SynonymsTF, Cf3, tissue factor, Cf-3, CD142
MMRRC Submission 040347-MU
Accession Numbers

Genbank: NM_010171

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2366 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location121723537-121735048 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 121732545 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029771]
Predicted Effect probably null
Transcript: ENSMUST00000029771
SMART Domains Protein: ENSMUSP00000029771
Gene: ENSMUSG00000028128

DomainStartEndE-ValueType
Pfam:Tissue_fac 12 110 1.1e-26 PFAM
Pfam:Interfer-bind 138 245 5.1e-26 PFAM
transmembrane domain 253 275 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197731
Predicted Effect probably benign
Transcript: ENSMUST00000199997
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes a membrane-bound glycoprotein that forms the primary physiological initiator of the blood coagulation process following vascular damage. The encoded protein binds to coagulation factor VIIa and the ensuing complex catalyzes the proteolytic activation of coagulation factors IX and X. Mice lacking encoded protein die in utero resulting from massive hemorrhaging in both extraembryonic and embryonic vessels. A severe deficiency of the encoded protein in mice results in impaired uterine homeostasis, shorter life spans due to spontaneous fatal hemorrhages and cardiac fibrosis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired blood vessel development, retarded growth, and, in most cases, midgestational lethality. On a mixed background, some mutants survive to birth and appear to be normal. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(5) Targeted, other(2)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,753,635 I726N probably damaging Het
A430089I19Rik T C 5: 94,303,113 K385E probably benign Het
A630091E08Rik G A 7: 98,543,742 noncoding transcript Het
Adamts5 C T 16: 85,862,758 G882D probably damaging Het
Arl6ip6 T C 2: 53,192,367 V82A probably benign Het
Cd38 T G 5: 43,903,590 probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a6 C A 9: 105,755,694 G1457V probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Cyp2d12 T A 15: 82,555,154 L3Q probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Drc1 A G 5: 30,366,550 *754W probably null Het
Erbin G A 13: 103,844,909 H503Y probably damaging Het
Gps1 A C 11: 120,788,119 I404L probably damaging Het
Hc T C 2: 35,013,636 N1002S probably benign Het
Impg2 T C 16: 56,259,873 I571T probably benign Het
Knop1 C A 7: 118,852,528 V323F possibly damaging Het
Kntc1 C T 5: 123,781,192 L845F probably damaging Het
Lsm5 T C 6: 56,703,018 D53G probably damaging Het
Lzts1 T C 8: 69,140,605 probably null Het
Matr3 A T 18: 35,588,395 N473I probably damaging Het
Med1 A G 11: 98,161,182 V452A probably damaging Het
Napsa T A 7: 44,582,485 D44E probably damaging Het
Nbeal1 T C 1: 60,251,352 F1036S probably damaging Het
Ncapg2 G A 12: 116,420,729 W270* probably null Het
Olfr312 C A 11: 58,831,213 Q20K probably benign Het
Pik3ca G A 3: 32,462,794 W1057* probably null Het
Pkd1l2 A T 8: 117,043,317 D1133E probably benign Het
Prox1 T A 1: 190,161,882 E122V probably damaging Het
Rest C A 5: 77,268,187 H83N probably benign Het
RP23-114B10.6 A T 8: 69,373,580 M112K unknown Het
Rundc3a A G 11: 102,397,665 I68V probably damaging Het
Slc9a3r1 G A 11: 115,163,628 V35M probably benign Het
Stx6 A T 1: 155,201,960 I238L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln3 C A 7: 104,141,049 Q611H probably damaging Het
Usp6nl T A 2: 6,440,959 H559Q probably benign Het
Vipr1 T G 9: 121,665,184 V277G probably benign Het
Zfp101 A T 17: 33,380,998 C595S probably benign Het
Zfp398 C T 6: 47,863,209 T124I possibly damaging Het
Other mutations in F3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02506:F3 APN 3 121731674 missense possibly damaging 0.83
G5030:F3 UTSW 3 121724999 missense probably damaging 1.00
R0020:F3 UTSW 3 121731616 missense probably damaging 1.00
R0020:F3 UTSW 3 121731616 missense probably damaging 1.00
R0622:F3 UTSW 3 121725019 missense probably damaging 1.00
R1367:F3 UTSW 3 121729374 missense probably damaging 0.98
R1371:F3 UTSW 3 121732510 missense probably damaging 1.00
R1925:F3 UTSW 3 121729383 missense probably damaging 1.00
R2100:F3 UTSW 3 121732433 missense possibly damaging 0.61
R2471:F3 UTSW 3 121725040 missense probably damaging 1.00
R4577:F3 UTSW 3 121734114 missense probably benign 0.02
R5752:F3 UTSW 3 121732404 missense probably damaging 1.00
R6440:F3 UTSW 3 121725037 missense probably damaging 1.00
R6713:F3 UTSW 3 121731674 missense possibly damaging 0.83
R6845:F3 UTSW 3 121732475 missense probably benign 0.02
R6867:F3 UTSW 3 121729371 missense possibly damaging 0.93
R7145:F3 UTSW 3 121731586 missense probably damaging 1.00
R7511:F3 UTSW 3 121731557 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGACTTAGAGCCCTGGTTTTGC -3'
(R):5'- AGAACCTGGCCCATTGCAAG -3'

Sequencing Primer
(F):5'- TCTCGGTGATTTGAGAACTCTATC -3'
(R):5'- ATTGCAAGTGCCCAGGG -3'
Posted On2014-10-30