Incidental Mutation 'R2366:Ubqln3'
ID 246334
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 040347-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R2366 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 103790256 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 611 (Q611H)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably damaging
Transcript: ENSMUST00000057254
AA Change: Q611H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: Q611H

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.0789 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630091E08Rik G A 7: 98,192,949 (GRCm39) noncoding transcript Het
Adamts5 C T 16: 85,659,646 (GRCm39) G882D probably damaging Het
Arl6ip6 T C 2: 53,082,379 (GRCm39) V82A probably benign Het
Brd10 A T 19: 29,731,035 (GRCm39) I726N probably damaging Het
Cd38 T G 5: 44,060,932 (GRCm39) probably benign Het
Cep250 G A 2: 155,834,552 (GRCm39) R2159K probably damaging Het
Col6a6 C A 9: 105,632,893 (GRCm39) G1457V probably damaging Het
Cyp2c69 T C 19: 39,866,038 (GRCm39) N185S probably benign Het
Cyp2d12 T A 15: 82,439,355 (GRCm39) L3Q probably damaging Het
Dnajc28 G A 16: 91,413,755 (GRCm39) T187M probably damaging Het
Drc1 A G 5: 30,523,894 (GRCm39) *754W probably null Het
Erbin G A 13: 103,981,417 (GRCm39) H503Y probably damaging Het
F3 G A 3: 121,526,194 (GRCm39) probably null Het
Gm10033 A T 8: 69,826,232 (GRCm39) M112K unknown Het
Gps1 A C 11: 120,678,945 (GRCm39) I404L probably damaging Het
Hc T C 2: 34,903,648 (GRCm39) N1002S probably benign Het
Impg2 T C 16: 56,080,236 (GRCm39) I571T probably benign Het
Knop1 C A 7: 118,451,751 (GRCm39) V323F possibly damaging Het
Kntc1 C T 5: 123,919,255 (GRCm39) L845F probably damaging Het
Lsm5 T C 6: 56,680,003 (GRCm39) D53G probably damaging Het
Lzts1 T C 8: 69,593,257 (GRCm39) probably null Het
Matr3 A T 18: 35,721,448 (GRCm39) N473I probably damaging Het
Med1 A G 11: 98,052,008 (GRCm39) V452A probably damaging Het
Napsa T A 7: 44,231,909 (GRCm39) D44E probably damaging Het
Nbeal1 T C 1: 60,290,511 (GRCm39) F1036S probably damaging Het
Ncapg2 G A 12: 116,384,349 (GRCm39) W270* probably null Het
Nherf1 G A 11: 115,054,454 (GRCm39) V35M probably benign Het
Or5af1 C A 11: 58,722,039 (GRCm39) Q20K probably benign Het
Pik3ca G A 3: 32,516,943 (GRCm39) W1057* probably null Het
Pkd1l2 A T 8: 117,770,056 (GRCm39) D1133E probably benign Het
Pramel39-ps T C 5: 94,450,972 (GRCm39) K385E probably benign Het
Prox1 T A 1: 189,894,079 (GRCm39) E122V probably damaging Het
Rest C A 5: 77,416,034 (GRCm39) H83N probably benign Het
Rundc3a A G 11: 102,288,491 (GRCm39) I68V probably damaging Het
Stx6 A T 1: 155,077,706 (GRCm39) I238L probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Usp6nl T A 2: 6,445,770 (GRCm39) H559Q probably benign Het
Vipr1 T G 9: 121,494,250 (GRCm39) V277G probably benign Het
Zfp101 A T 17: 33,599,972 (GRCm39) C595S probably benign Het
Zfp398 C T 6: 47,840,143 (GRCm39) T124I possibly damaging Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGCAGCTGTATTCAAGAATAGGAG -3'
(R):5'- GTTCATGCCCTGCCTAACAG -3'

Sequencing Primer
(F):5'- GCTGTATTCAAGAATAGGAGAACTAG -3'
(R):5'- CTGCCTAACAGGGTTGAATGG -3'
Posted On 2014-10-30