Incidental Mutation 'R2366:Ncapg2'
ID246346
Institutional Source Beutler Lab
Gene Symbol Ncapg2
Ensembl Gene ENSMUSG00000042029
Gene Namenon-SMC condensin II complex, subunit G2
SynonymsLuzp5, 5830426I05Rik, mCAP-G2, Mtb
MMRRC Submission 040347-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2366 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location116405402-116463731 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 116420729 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 270 (W270*)
Ref Sequence ENSEMBL: ENSMUSP00000081889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084828]
Predicted Effect probably null
Transcript: ENSMUST00000084828
AA Change: W270*
SMART Domains Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029
AA Change: W270*

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Condensin2nSMC 212 361 7.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220608
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,753,635 I726N probably damaging Het
A430089I19Rik T C 5: 94,303,113 K385E probably benign Het
A630091E08Rik G A 7: 98,543,742 noncoding transcript Het
Adamts5 C T 16: 85,862,758 G882D probably damaging Het
Arl6ip6 T C 2: 53,192,367 V82A probably benign Het
Cd38 T G 5: 43,903,590 probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a6 C A 9: 105,755,694 G1457V probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Cyp2d12 T A 15: 82,555,154 L3Q probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Drc1 A G 5: 30,366,550 *754W probably null Het
Erbin G A 13: 103,844,909 H503Y probably damaging Het
F3 G A 3: 121,732,545 probably null Het
Gps1 A C 11: 120,788,119 I404L probably damaging Het
Hc T C 2: 35,013,636 N1002S probably benign Het
Impg2 T C 16: 56,259,873 I571T probably benign Het
Knop1 C A 7: 118,852,528 V323F possibly damaging Het
Kntc1 C T 5: 123,781,192 L845F probably damaging Het
Lsm5 T C 6: 56,703,018 D53G probably damaging Het
Lzts1 T C 8: 69,140,605 probably null Het
Matr3 A T 18: 35,588,395 N473I probably damaging Het
Med1 A G 11: 98,161,182 V452A probably damaging Het
Napsa T A 7: 44,582,485 D44E probably damaging Het
Nbeal1 T C 1: 60,251,352 F1036S probably damaging Het
Olfr312 C A 11: 58,831,213 Q20K probably benign Het
Pik3ca G A 3: 32,462,794 W1057* probably null Het
Pkd1l2 A T 8: 117,043,317 D1133E probably benign Het
Prox1 T A 1: 190,161,882 E122V probably damaging Het
Rest C A 5: 77,268,187 H83N probably benign Het
RP23-114B10.6 A T 8: 69,373,580 M112K unknown Het
Rundc3a A G 11: 102,397,665 I68V probably damaging Het
Slc9a3r1 G A 11: 115,163,628 V35M probably benign Het
Stx6 A T 1: 155,201,960 I238L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln3 C A 7: 104,141,049 Q611H probably damaging Het
Usp6nl T A 2: 6,440,959 H559Q probably benign Het
Vipr1 T G 9: 121,665,184 V277G probably benign Het
Zfp101 A T 17: 33,380,998 C595S probably benign Het
Zfp398 C T 6: 47,863,209 T124I possibly damaging Het
Other mutations in Ncapg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ncapg2 APN 12 116424650 missense possibly damaging 0.54
IGL01694:Ncapg2 APN 12 116407230 utr 5 prime probably benign
IGL01724:Ncapg2 APN 12 116426711 missense probably damaging 1.00
IGL01792:Ncapg2 APN 12 116425818 missense probably damaging 0.99
IGL02098:Ncapg2 APN 12 116444332 missense possibly damaging 0.59
IGL02136:Ncapg2 APN 12 116460583 missense probably benign
IGL02409:Ncapg2 APN 12 116420717 missense probably damaging 1.00
IGL02580:Ncapg2 APN 12 116420689 missense probably damaging 1.00
IGL02653:Ncapg2 APN 12 116425906 critical splice donor site probably null
IGL03073:Ncapg2 APN 12 116452274 missense probably benign 0.01
IGL03114:Ncapg2 APN 12 116452373 splice site probably benign
IGL03199:Ncapg2 APN 12 116419236 missense probably damaging 1.00
IGL03328:Ncapg2 APN 12 116440057 missense possibly damaging 0.90
P0033:Ncapg2 UTSW 12 116438635 missense probably benign 0.03
R0008:Ncapg2 UTSW 12 116429835 missense probably damaging 1.00
R0194:Ncapg2 UTSW 12 116420683 splice site probably null
R0379:Ncapg2 UTSW 12 116443075 missense probably damaging 1.00
R0568:Ncapg2 UTSW 12 116423215 missense probably damaging 1.00
R0771:Ncapg2 UTSW 12 116413159 nonsense probably null
R1016:Ncapg2 UTSW 12 116438675 missense probably damaging 1.00
R1507:Ncapg2 UTSW 12 116460566 missense probably benign 0.00
R1524:Ncapg2 UTSW 12 116434578 splice site probably benign
R1596:Ncapg2 UTSW 12 116419236 missense probably damaging 1.00
R1635:Ncapg2 UTSW 12 116434685 frame shift probably null
R1752:Ncapg2 UTSW 12 116426718 missense probably damaging 1.00
R2164:Ncapg2 UTSW 12 116450475 splice site probably null
R2266:Ncapg2 UTSW 12 116429676 missense probably damaging 1.00
R2924:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R2925:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R3828:Ncapg2 UTSW 12 116407318 splice site probably benign
R3829:Ncapg2 UTSW 12 116407318 splice site probably benign
R4384:Ncapg2 UTSW 12 116439877 critical splice donor site probably null
R4651:Ncapg2 UTSW 12 116425787 missense probably damaging 1.00
R4701:Ncapg2 UTSW 12 116440618 missense probably benign
R4821:Ncapg2 UTSW 12 116415457 missense probably damaging 0.99
R4845:Ncapg2 UTSW 12 116440588 missense probably damaging 0.96
R5135:Ncapg2 UTSW 12 116427786 missense possibly damaging 0.64
R5294:Ncapg2 UTSW 12 116427794 missense possibly damaging 0.54
R5334:Ncapg2 UTSW 12 116426637 missense probably damaging 1.00
R5588:Ncapg2 UTSW 12 116413077 missense possibly damaging 0.95
R5888:Ncapg2 UTSW 12 116425800 missense possibly damaging 0.84
R5938:Ncapg2 UTSW 12 116429657 missense probably damaging 1.00
R5978:Ncapg2 UTSW 12 116424671 missense possibly damaging 0.68
R6016:Ncapg2 UTSW 12 116426607 missense probably damaging 1.00
R6026:Ncapg2 UTSW 12 116443021 missense possibly damaging 0.73
R6155:Ncapg2 UTSW 12 116438011 missense possibly damaging 0.83
R6509:Ncapg2 UTSW 12 116427756 missense probably damaging 1.00
R6675:Ncapg2 UTSW 12 116434661 missense possibly damaging 0.71
R6912:Ncapg2 UTSW 12 116426582 missense probably benign
R7069:Ncapg2 UTSW 12 116424717 splice site probably null
R7339:Ncapg2 UTSW 12 116414834 missense probably damaging 0.96
R7440:Ncapg2 UTSW 12 116450413 missense possibly damaging 0.89
R7445:Ncapg2 UTSW 12 116419268 missense possibly damaging 0.50
R7704:Ncapg2 UTSW 12 116419277 missense probably damaging 1.00
R8061:Ncapg2 UTSW 12 116426577 missense probably benign
R8132:Ncapg2 UTSW 12 116444347 missense possibly damaging 0.93
R8166:Ncapg2 UTSW 12 116412416 missense probably benign 0.00
X0020:Ncapg2 UTSW 12 116424707 missense probably damaging 1.00
Z1177:Ncapg2 UTSW 12 116438605 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTGGGCCCATGTTGTCAG -3'
(R):5'- CCTCAATGACTCAGCCTGTC -3'

Sequencing Primer
(F):5'- CCCATGTTGTCAGGATTAGGGTAAC -3'
(R):5'- AGCCTGTCATACTTCTATCAGCATG -3'
Posted On2014-10-30