Incidental Mutation 'R2366:Impg2'
ID 246350
Institutional Source Beutler Lab
Gene Symbol Impg2
Ensembl Gene ENSMUSG00000035270
Gene Name interphotoreceptor matrix proteoglycan 2
Synonyms IPM200, Spacrcan, PG10.2
MMRRC Submission 040347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R2366 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 56204313-56273756 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 56259873 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 571 (I571T)
Ref Sequence ENSEMBL: ENSMUSP00000125135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069936] [ENSMUST00000160116]
AlphaFold Q80XH2
Predicted Effect probably benign
Transcript: ENSMUST00000069936
AA Change: I680T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000063648
Gene: ENSMUSG00000035270
AA Change: I680T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 66 74 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
SEA 235 345 7.7e-29 SMART
low complexity region 396 407 N/A INTRINSIC
low complexity region 419 444 N/A INTRINSIC
SEA 895 1018 2.18e-28 SMART
EGF_like 1016 1054 3.57e1 SMART
EGF_like 1056 1096 3.04e1 SMART
transmembrane domain 1105 1127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160116
AA Change: I571T

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125135
Gene: ENSMUSG00000035270
AA Change: I571T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 66 74 N/A INTRINSIC
low complexity region 207 220 N/A INTRINSIC
SEA 235 345 7.7e-29 SMART
SEA 786 909 2.18e-28 SMART
EGF_like 907 945 3.57e1 SMART
EGF_like 947 987 3.04e1 SMART
transmembrane domain 996 1018 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds chondroitin sulfate and hyaluronan and is a proteoglycan. The encoded protein plays a role in the organization of the interphotoreceptor matrix and may promote the growth and maintenance of the light-sensitive photoreceptor outer segment. Defects in this gene are a cause of retinitis pigmentosa type 56 and maculopathy, IMPG2-related.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,753,635 I726N probably damaging Het
A430089I19Rik T C 5: 94,303,113 K385E probably benign Het
A630091E08Rik G A 7: 98,543,742 noncoding transcript Het
Adamts5 C T 16: 85,862,758 G882D probably damaging Het
Arl6ip6 T C 2: 53,192,367 V82A probably benign Het
Cd38 T G 5: 43,903,590 probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a6 C A 9: 105,755,694 G1457V probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Cyp2d12 T A 15: 82,555,154 L3Q probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Drc1 A G 5: 30,366,550 *754W probably null Het
Erbin G A 13: 103,844,909 H503Y probably damaging Het
F3 G A 3: 121,732,545 probably null Het
Gps1 A C 11: 120,788,119 I404L probably damaging Het
Hc T C 2: 35,013,636 N1002S probably benign Het
Knop1 C A 7: 118,852,528 V323F possibly damaging Het
Kntc1 C T 5: 123,781,192 L845F probably damaging Het
Lsm5 T C 6: 56,703,018 D53G probably damaging Het
Lzts1 T C 8: 69,140,605 probably null Het
Matr3 A T 18: 35,588,395 N473I probably damaging Het
Med1 A G 11: 98,161,182 V452A probably damaging Het
Napsa T A 7: 44,582,485 D44E probably damaging Het
Nbeal1 T C 1: 60,251,352 F1036S probably damaging Het
Ncapg2 G A 12: 116,420,729 W270* probably null Het
Olfr312 C A 11: 58,831,213 Q20K probably benign Het
Pik3ca G A 3: 32,462,794 W1057* probably null Het
Pkd1l2 A T 8: 117,043,317 D1133E probably benign Het
Prox1 T A 1: 190,161,882 E122V probably damaging Het
Rest C A 5: 77,268,187 H83N probably benign Het
RP23-114B10.6 A T 8: 69,373,580 M112K unknown Het
Rundc3a A G 11: 102,397,665 I68V probably damaging Het
Slc9a3r1 G A 11: 115,163,628 V35M probably benign Het
Stx6 A T 1: 155,201,960 I238L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln3 C A 7: 104,141,049 Q611H probably damaging Het
Usp6nl T A 2: 6,440,959 H559Q probably benign Het
Vipr1 T G 9: 121,665,184 V277G probably benign Het
Zfp101 A T 17: 33,380,998 C595S probably benign Het
Zfp398 C T 6: 47,863,209 T124I possibly damaging Het
Other mutations in Impg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Impg2 APN 16 56261605 nonsense probably null
IGL01097:Impg2 APN 16 56260647 critical splice donor site probably null
IGL01115:Impg2 APN 16 56259440 missense possibly damaging 0.61
IGL01545:Impg2 APN 16 56225717 splice site probably benign
IGL01644:Impg2 APN 16 56259870 missense probably benign 0.04
IGL01690:Impg2 APN 16 56205205 missense probably damaging 0.97
IGL01781:Impg2 APN 16 56252225 missense probably benign 0.21
IGL01801:Impg2 APN 16 56236748 missense probably damaging 0.97
IGL01980:Impg2 APN 16 56221527 missense probably damaging 0.99
IGL02059:Impg2 APN 16 56259972 missense probably damaging 1.00
IGL02140:Impg2 APN 16 56259468 missense probably benign 0.05
IGL02206:Impg2 APN 16 56259597 missense possibly damaging 0.92
IGL02245:Impg2 APN 16 56269082 missense probably damaging 0.96
IGL02584:Impg2 APN 16 56265011 missense probably damaging 1.00
IGL03061:Impg2 APN 16 56268416 missense probably damaging 1.00
IGL03123:Impg2 APN 16 56267122 missense probably damaging 1.00
IGL03280:Impg2 APN 16 56268268 nonsense probably null
R0051:Impg2 UTSW 16 56258048 missense probably damaging 1.00
R0117:Impg2 UTSW 16 56261642 missense probably damaging 0.99
R0193:Impg2 UTSW 16 56265049 nonsense probably null
R0270:Impg2 UTSW 16 56269015 missense possibly damaging 0.88
R0326:Impg2 UTSW 16 56260485 missense probably damaging 1.00
R0330:Impg2 UTSW 16 56252264 missense probably damaging 0.99
R0812:Impg2 UTSW 16 56257939 intron probably benign
R1074:Impg2 UTSW 16 56265178 splice site probably benign
R1283:Impg2 UTSW 16 56257939 intron probably benign
R1618:Impg2 UTSW 16 56259858 missense probably damaging 0.97
R1708:Impg2 UTSW 16 56265078 missense probably benign 0.10
R1713:Impg2 UTSW 16 56260526 missense probably benign 0.25
R1827:Impg2 UTSW 16 56267220 missense possibly damaging 0.62
R1853:Impg2 UTSW 16 56260277 missense probably damaging 1.00
R2064:Impg2 UTSW 16 56243630 critical splice donor site probably null
R2100:Impg2 UTSW 16 56231385 splice site probably null
R2125:Impg2 UTSW 16 56265064 missense probably damaging 1.00
R2128:Impg2 UTSW 16 56218379 missense probably damaging 1.00
R2195:Impg2 UTSW 16 56260134 missense probably benign 0.39
R2247:Impg2 UTSW 16 56268264 missense probably damaging 0.97
R2411:Impg2 UTSW 16 56252154 missense probably damaging 1.00
R4193:Impg2 UTSW 16 56268411 missense probably benign 0.00
R4356:Impg2 UTSW 16 56260164 missense probably damaging 1.00
R4424:Impg2 UTSW 16 56260025 missense possibly damaging 0.56
R4575:Impg2 UTSW 16 56261732 missense probably damaging 1.00
R4766:Impg2 UTSW 16 56257939 intron probably benign
R5024:Impg2 UTSW 16 56260100 missense probably damaging 0.97
R5278:Impg2 UTSW 16 56221517 missense probably benign 0.06
R5383:Impg2 UTSW 16 56243626 missense probably benign 0.03
R5766:Impg2 UTSW 16 56259820 missense possibly damaging 0.73
R5909:Impg2 UTSW 16 56258136 missense probably damaging 0.99
R6525:Impg2 UTSW 16 56205149 missense probably damaging 1.00
R6684:Impg2 UTSW 16 56259929 missense probably benign 0.33
R6692:Impg2 UTSW 16 56252333 missense probably damaging 1.00
R6711:Impg2 UTSW 16 56265086 missense probably damaging 1.00
R6909:Impg2 UTSW 16 56204584 missense probably damaging 0.97
R6959:Impg2 UTSW 16 56268330 missense probably benign 0.01
R7226:Impg2 UTSW 16 56267104 nonsense probably null
R7456:Impg2 UTSW 16 56259913 missense probably benign 0.03
R7528:Impg2 UTSW 16 56260380 missense possibly damaging 0.86
R7532:Impg2 UTSW 16 56267180 missense probably damaging 0.96
R7601:Impg2 UTSW 16 56260031 missense probably benign 0.22
R7803:Impg2 UTSW 16 56267150 missense probably damaging 0.99
R8063:Impg2 UTSW 16 56261456 intron probably benign
R8251:Impg2 UTSW 16 56259597 missense possibly damaging 0.92
R8292:Impg2 UTSW 16 56260626 missense probably damaging 1.00
R8481:Impg2 UTSW 16 56252266 missense possibly damaging 0.76
R8524:Impg2 UTSW 16 56218394 missense probably benign 0.03
R8782:Impg2 UTSW 16 56259455 missense probably damaging 0.99
R8795:Impg2 UTSW 16 56260248 missense probably benign 0.25
R8901:Impg2 UTSW 16 56252165 missense probably damaging 1.00
R9243:Impg2 UTSW 16 56231460 missense probably damaging 1.00
R9352:Impg2 UTSW 16 56252107 missense probably benign 0.00
R9645:Impg2 UTSW 16 56218404 missense probably damaging 0.99
X0023:Impg2 UTSW 16 56259876 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGCCATGGAGTGAGACTTC -3'
(R):5'- TGACTGGATGATTCTGTATGTACC -3'

Sequencing Primer
(F):5'- TGAGACTTCATTAGAGAAGACCAC -3'
(R):5'- ACCTCATCTGTTTTCTTAGTGGAAG -3'
Posted On 2014-10-30