Mutagenetix > Incidental Mutation

Incidental Mutation 'R2367:Kntc1'

246369

Institutional Source

Beutler Lab

Gene Symbol

Kntc1

Ensembl Gene

ENSMUSG00000029414

Gene Name

kinetochore associated 1

Synonyms

MMRRC Submission

040348-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R2367 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

123749716-123821593 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 123781192 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 845 (L845F)

Ref Sequence

ENSEMBL: ENSMUSP00000031366 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031366]

AlphaFold

Q8C3Y4

Predicted Effect

probably damaging
Transcript: ENSMUST00000031366
AA Change: L845F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031366
Gene: ENSMUSG00000029414
AA Change: L845F

Domain	Start	End	E-Value	Type
low complexity region	345	357	N/A	INTRINSIC
low complexity region	747	764	N/A	INTRINSIC
low complexity region	1033	1044	N/A	INTRINSIC
Pfam:Rod_C	1579	2128	3.2e-256	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197665

Predicted Effect

unknown
Transcript: ENSMUST00000198841
AA Change: L2F

Meta Mutation Damage Score

0.4240

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice have a kinked tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adipoq	T	C	16: 23,155,319	V32A	probably benign	Het
Ceacam3	T	C	7: 17,151,888		probably null	Het
Cep250	G	A	2: 155,992,632	R2159K	probably damaging	Het
Cfap46	C	A	7: 139,653,498	V296F	probably damaging	Het
Ctdspl2	T	C	2: 121,987,018	V182A	probably benign	Het
Cyp2c69	T	C	19: 39,877,594	N185S	probably benign	Het
Daxx	C	T	17: 33,911,847	R279W	probably benign	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Galnt13	A	T	2: 55,112,944	M552L	probably benign	Het
Gstt2	C	T	10: 75,832,690	G108S	probably benign	Het
Heatr1	T	A	13: 12,433,724	L422Q	probably damaging	Het
Krtap26-1	C	A	16: 88,647,325	R136L	probably benign	Het
Mrgprb5	C	T	7: 48,168,599	W129*	probably null	Het
Ms4a3	G	A	19: 11,629,744	P186S	probably benign	Het
Myo15	T	A	11: 60,517,238	M3184K	probably damaging	Het
Olfr1044	T	C	2: 86,171,637	Y60C	probably damaging	Het
Olig2	G	A	16: 91,226,566	R56Q	possibly damaging	Het
Pgap3	C	T	11: 98,391,159		probably null	Het
Phgdh	C	G	3: 98,314,296	G440A	probably benign	Het
Scn1a	T	C	2: 66,327,679	Q450R	probably damaging	Het
Sema4d	CGGGG	CGGGGGGG	13: 51,703,140		probably benign	Het
Sik1	C	T	17: 31,846,297	V776I	possibly damaging	Het
Slc25a39	T	A	11: 102,403,651	T316S	possibly damaging	Het
Slc38a10	C	T	11: 120,110,261	E578K	probably benign	Het
Slc44a5	T	A	3: 154,247,809	I276K	possibly damaging	Het
Smarcc2	A	G	10: 128,482,167	T610A	possibly damaging	Het
Spag9	G	A	11: 94,116,757	S1090N	probably damaging	Het
Tpr	T	C	1: 150,433,728	V277A	probably damaging	Het
Traf3ip1	T	G	1: 91,507,520	S314A	possibly damaging	Het
Tril	T	A	6: 53,819,166	D357V	probably damaging	Het
Tube1	T	C	10: 39,144,919	L267P	probably damaging	Het
Vmn1r11	A	G	6: 57,137,431	I27V	probably benign	Het

Other mutations in Kntc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Kntc1	APN	5	123790159	missense	probably benign	0.05
IGL00514:Kntc1	APN	5	123791527	missense	probably benign	0.00
IGL01103:Kntc1	APN	5	123764220	missense	probably damaging	0.96
IGL01106:Kntc1	APN	5	123762603	missense	probably benign	0.01
IGL01357:Kntc1	APN	5	123757814	missense	probably damaging	1.00
IGL01367:Kntc1	APN	5	123758483	missense	probably damaging	1.00
IGL01538:Kntc1	APN	5	123781658	missense	probably damaging	1.00
IGL01546:Kntc1	APN	5	123765005	missense	probably benign	0.02
IGL01595:Kntc1	APN	5	123803695	missense	probably benign	0.30
IGL01725:Kntc1	APN	5	123764190	missense	probably benign
IGL01916:Kntc1	APN	5	123801913	missense	probably damaging	1.00
IGL01936:Kntc1	APN	5	123811376	missense	probably damaging	1.00
IGL01942:Kntc1	APN	5	123778267	missense	probably damaging	1.00
IGL01973:Kntc1	APN	5	123765958	missense	probably damaging	1.00
IGL01982:Kntc1	APN	5	123809096	missense	probably benign	0.12
IGL02145:Kntc1	APN	5	123762598	missense	possibly damaging	0.80
IGL02510:Kntc1	APN	5	123819062	missense	probably benign	0.03
IGL02611:Kntc1	APN	5	123812065	missense	probably damaging	1.00
IGL02669:Kntc1	APN	5	123755664	splice site	probably benign
IGL02737:Kntc1	APN	5	123819120	missense	probably benign	0.17
IGL02793:Kntc1	APN	5	123778277	splice site	probably null
IGL02809:Kntc1	APN	5	123776582	missense	probably damaging	1.00
IGL02860:Kntc1	APN	5	123769873	missense	possibly damaging	0.49
IGL02875:Kntc1	APN	5	123778277	splice site	probably null
IGL02931:Kntc1	APN	5	123799811	missense	probably damaging	1.00
IGL03169:Kntc1	APN	5	123775821	missense	possibly damaging	0.80
IGL03267:Kntc1	APN	5	123758480	missense	probably damaging	1.00
R0006:Kntc1	UTSW	5	123789138	missense	probably benign	0.19
R0006:Kntc1	UTSW	5	123789138	missense	probably benign	0.19
R0017:Kntc1	UTSW	5	123780981	missense	probably damaging	1.00
R0125:Kntc1	UTSW	5	123765057	splice site	probably benign
R0324:Kntc1	UTSW	5	123778112	missense	probably damaging	1.00
R0580:Kntc1	UTSW	5	123803669	missense	probably benign	0.00
R0608:Kntc1	UTSW	5	123786074	missense	probably damaging	0.98
R0725:Kntc1	UTSW	5	123769704	missense	possibly damaging	0.92
R0733:Kntc1	UTSW	5	123790916	missense	probably null
R0781:Kntc1	UTSW	5	123799902	splice site	probably benign
R0787:Kntc1	UTSW	5	123796104	missense	probably benign
R1250:Kntc1	UTSW	5	123784199	missense	possibly damaging	0.71
R1253:Kntc1	UTSW	5	123810862	frame shift	probably null
R1467:Kntc1	UTSW	5	123786984	missense	probably benign	0.04
R1467:Kntc1	UTSW	5	123786984	missense	probably benign	0.04
R1481:Kntc1	UTSW	5	123778275	missense	probably benign	0.00
R1572:Kntc1	UTSW	5	123772113	missense	probably damaging	0.99
R1624:Kntc1	UTSW	5	123758477	missense	possibly damaging	0.48
R1749:Kntc1	UTSW	5	123789099	missense	probably benign	0.00
R1993:Kntc1	UTSW	5	123759099	critical splice donor site	probably null
R1993:Kntc1	UTSW	5	123810811	critical splice acceptor site	probably null
R2071:Kntc1	UTSW	5	123794277	splice site	probably null
R2237:Kntc1	UTSW	5	123803670	missense	possibly damaging	0.50
R2239:Kntc1	UTSW	5	123803670	missense	possibly damaging	0.50
R2366:Kntc1	UTSW	5	123781192	missense	probably damaging	1.00
R2382:Kntc1	UTSW	5	123760348	missense	probably damaging	0.99
R2389:Kntc1	UTSW	5	123781192	missense	probably damaging	1.00
R2413:Kntc1	UTSW	5	123764149	missense	probably benign	0.01
R2442:Kntc1	UTSW	5	123810859	missense	probably damaging	1.00
R2504:Kntc1	UTSW	5	123778347	nonsense	probably null
R2943:Kntc1	UTSW	5	123797784	missense	possibly damaging	0.68
R3116:Kntc1	UTSW	5	123802058	missense	probably damaging	1.00
R4107:Kntc1	UTSW	5	123762598	missense	probably damaging	0.99
R4176:Kntc1	UTSW	5	123776617	missense	possibly damaging	0.76
R4275:Kntc1	UTSW	5	123767779	missense	probably damaging	1.00
R4440:Kntc1	UTSW	5	123794153	missense	probably damaging	1.00
R4575:Kntc1	UTSW	5	123765955	missense	probably damaging	1.00
R4576:Kntc1	UTSW	5	123765955	missense	probably damaging	1.00
R4578:Kntc1	UTSW	5	123765955	missense	probably damaging	1.00
R4612:Kntc1	UTSW	5	123812643	missense	probably damaging	1.00
R4704:Kntc1	UTSW	5	123811433	missense	probably damaging	0.96
R4720:Kntc1	UTSW	5	123765023	missense	possibly damaging	0.65
R4784:Kntc1	UTSW	5	123816762	missense	possibly damaging	0.89
R4785:Kntc1	UTSW	5	123816762	missense	possibly damaging	0.89
R4824:Kntc1	UTSW	5	123790133	nonsense	probably null
R4847:Kntc1	UTSW	5	123802274	missense	probably benign	0.18
R4849:Kntc1	UTSW	5	123759065	missense	probably benign	0.02
R4904:Kntc1	UTSW	5	123778333	missense	possibly damaging	0.47
R4922:Kntc1	UTSW	5	123802246	missense	probably damaging	0.99
R5080:Kntc1	UTSW	5	123762586	missense	possibly damaging	0.68
R5114:Kntc1	UTSW	5	123781055	critical splice donor site	probably null
R5171:Kntc1	UTSW	5	123799844	missense	probably benign	0.01
R5220:Kntc1	UTSW	5	123812097	missense	probably damaging	1.00
R5226:Kntc1	UTSW	5	123794172	missense	probably benign	0.09
R5278:Kntc1	UTSW	5	123781014	missense	probably damaging	1.00
R5329:Kntc1	UTSW	5	123764191	missense	probably benign	0.02
R5496:Kntc1	UTSW	5	123784182	missense	probably benign	0.00
R5503:Kntc1	UTSW	5	123819876	missense	possibly damaging	0.81
R5633:Kntc1	UTSW	5	123819057	missense	probably damaging	0.99
R5638:Kntc1	UTSW	5	123818475	missense	possibly damaging	0.65
R5697:Kntc1	UTSW	5	123765007	missense	probably benign	0.00
R5757:Kntc1	UTSW	5	123807309	critical splice donor site	probably null
R5773:Kntc1	UTSW	5	123794157	missense	probably damaging	1.00
R5940:Kntc1	UTSW	5	123786195	missense	probably benign	0.05
R6019:Kntc1	UTSW	5	123762516	missense	probably benign	0.03
R6230:Kntc1	UTSW	5	123789009	splice site	probably null
R6437:Kntc1	UTSW	5	123769691	missense	probably damaging	0.98
R6888:Kntc1	UTSW	5	123811310	missense	probably damaging	1.00
R6907:Kntc1	UTSW	5	123801825	missense	probably damaging	1.00
R7123:Kntc1	UTSW	5	123781726	missense	probably damaging	1.00
R7262:Kntc1	UTSW	5	123786973	missense	probably benign	0.18
R7381:Kntc1	UTSW	5	123810908	missense	probably benign	0.12
R7485:Kntc1	UTSW	5	123786956	missense	possibly damaging	0.79
R7512:Kntc1	UTSW	5	123790938	missense	probably damaging	1.00
R7581:Kntc1	UTSW	5	123816755	missense	probably benign	0.05
R7687:Kntc1	UTSW	5	123759089	missense	probably benign	0.01
R7798:Kntc1	UTSW	5	123786294	missense	probably benign
R7798:Kntc1	UTSW	5	123819117	missense	possibly damaging	0.94
R7871:Kntc1	UTSW	5	123784227	missense	probably damaging	1.00
R7876:Kntc1	UTSW	5	123775787	missense	probably damaging	1.00
R7947:Kntc1	UTSW	5	123781888	missense	unknown
R7997:Kntc1	UTSW	5	123778054	missense	probably damaging	0.96
R8231:Kntc1	UTSW	5	123782896	missense	possibly damaging	0.47
R8257:Kntc1	UTSW	5	123758523	critical splice donor site	probably null
R8345:Kntc1	UTSW	5	123786930	missense	probably benign	0.37
R8354:Kntc1	UTSW	5	123778267	missense	probably damaging	1.00
R8732:Kntc1	UTSW	5	123790117	missense	probably benign	0.00
R8754:Kntc1	UTSW	5	123759052	missense	probably benign	0.01
R8947:Kntc1	UTSW	5	123786978	missense	probably benign	0.01
R9041:Kntc1	UTSW	5	123789030	missense	probably benign	0.00
R9182:Kntc1	UTSW	5	123802292	missense	probably damaging	1.00
R9432:Kntc1	UTSW	5	123787049	missense	possibly damaging	0.93
R9460:Kntc1	UTSW	5	123803315	nonsense	probably null
R9468:Kntc1	UTSW	5	123816713	missense	probably damaging	1.00
R9643:Kntc1	UTSW	5	123811377	missense	probably damaging	1.00
R9646:Kntc1	UTSW	5	123759056	missense	probably benign	0.01
R9721:Kntc1	UTSW	5	123801885	missense	probably benign	0.01
R9789:Kntc1	UTSW	5	123760643	missense	possibly damaging	0.87
X0027:Kntc1	UTSW	5	123810929	missense	probably benign	0.00
X0065:Kntc1	UTSW	5	123778037	nonsense	probably null
X0067:Kntc1	UTSW	5	123778074	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- CTTTGATGCTGTGCTGAAGATAATG -3'
(R):5'- TGACTCTCTCCCACATAATAAGTC -3'

Sequencing Primer
(F):5'- ATAATGTACAAGGCGGTGGTTCCC -3'
(R):5'- TCCCACATAATAAGTCTAGCTCTG -3'

Posted On

2014-10-30