Incidental Mutation 'R2367:Kntc1'
ID 246369
Institutional Source Beutler Lab
Gene Symbol Kntc1
Ensembl Gene ENSMUSG00000029414
Gene Name kinetochore associated 1
Synonyms jgl
MMRRC Submission 040348-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R2367 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 123887779-123959656 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 123919255 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 845 (L845F)
Ref Sequence ENSEMBL: ENSMUSP00000031366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031366]
AlphaFold Q8C3Y4
Predicted Effect probably damaging
Transcript: ENSMUST00000031366
AA Change: L845F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031366
Gene: ENSMUSG00000029414
AA Change: L845F

DomainStartEndE-ValueType
low complexity region 345 357 N/A INTRINSIC
low complexity region 747 764 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
Pfam:Rod_C 1579 2128 3.2e-256 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197665
Predicted Effect unknown
Transcript: ENSMUST00000198841
AA Change: L2F
Meta Mutation Damage Score 0.4240 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice have a kinked tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq T C 16: 22,974,069 (GRCm39) V32A probably benign Het
Ceacam3 T C 7: 16,885,813 (GRCm39) probably null Het
Cep250 G A 2: 155,834,552 (GRCm39) R2159K probably damaging Het
Cfap46 C A 7: 139,233,414 (GRCm39) V296F probably damaging Het
Ctdspl2 T C 2: 121,817,499 (GRCm39) V182A probably benign Het
Cyp2c69 T C 19: 39,866,038 (GRCm39) N185S probably benign Het
Daxx C T 17: 34,130,821 (GRCm39) R279W probably benign Het
Dnajc28 G A 16: 91,413,755 (GRCm39) T187M probably damaging Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Galnt13 A T 2: 55,002,956 (GRCm39) M552L probably benign Het
Gstt2 C T 10: 75,668,524 (GRCm39) G108S probably benign Het
Heatr1 T A 13: 12,448,605 (GRCm39) L422Q probably damaging Het
Krtap26-1 C A 16: 88,444,213 (GRCm39) R136L probably benign Het
Mrgprb5 C T 7: 47,818,347 (GRCm39) W129* probably null Het
Ms4a3 G A 19: 11,607,108 (GRCm39) P186S probably benign Het
Myo15a T A 11: 60,408,064 (GRCm39) M3184K probably damaging Het
Olig2 G A 16: 91,023,454 (GRCm39) R56Q possibly damaging Het
Or8u9 T C 2: 86,001,981 (GRCm39) Y60C probably damaging Het
Pgap3 C T 11: 98,281,985 (GRCm39) probably null Het
Phgdh C G 3: 98,221,612 (GRCm39) G440A probably benign Het
Scn1a T C 2: 66,158,023 (GRCm39) Q450R probably damaging Het
Sema4d CGGGG CGGGGGGG 13: 51,857,176 (GRCm39) probably benign Het
Sik1 C T 17: 32,065,271 (GRCm39) V776I possibly damaging Het
Slc25a39 T A 11: 102,294,477 (GRCm39) T316S possibly damaging Het
Slc38a10 C T 11: 120,001,087 (GRCm39) E578K probably benign Het
Slc44a5 T A 3: 153,953,446 (GRCm39) I276K possibly damaging Het
Smarcc2 A G 10: 128,318,036 (GRCm39) T610A possibly damaging Het
Spag9 G A 11: 94,007,583 (GRCm39) S1090N probably damaging Het
Tpr T C 1: 150,309,479 (GRCm39) V277A probably damaging Het
Traf3ip1 T G 1: 91,435,242 (GRCm39) S314A possibly damaging Het
Tril T A 6: 53,796,151 (GRCm39) D357V probably damaging Het
Tube1 T C 10: 39,020,915 (GRCm39) L267P probably damaging Het
Vmn1r11 A G 6: 57,114,416 (GRCm39) I27V probably benign Het
Other mutations in Kntc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kntc1 APN 5 123,928,222 (GRCm39) missense probably benign 0.05
IGL00514:Kntc1 APN 5 123,929,590 (GRCm39) missense probably benign 0.00
IGL01103:Kntc1 APN 5 123,902,283 (GRCm39) missense probably damaging 0.96
IGL01106:Kntc1 APN 5 123,900,666 (GRCm39) missense probably benign 0.01
IGL01357:Kntc1 APN 5 123,895,877 (GRCm39) missense probably damaging 1.00
IGL01367:Kntc1 APN 5 123,896,546 (GRCm39) missense probably damaging 1.00
IGL01538:Kntc1 APN 5 123,919,721 (GRCm39) missense probably damaging 1.00
IGL01546:Kntc1 APN 5 123,903,068 (GRCm39) missense probably benign 0.02
IGL01595:Kntc1 APN 5 123,941,758 (GRCm39) missense probably benign 0.30
IGL01725:Kntc1 APN 5 123,902,253 (GRCm39) missense probably benign
IGL01916:Kntc1 APN 5 123,939,976 (GRCm39) missense probably damaging 1.00
IGL01936:Kntc1 APN 5 123,949,439 (GRCm39) missense probably damaging 1.00
IGL01942:Kntc1 APN 5 123,916,330 (GRCm39) missense probably damaging 1.00
IGL01973:Kntc1 APN 5 123,904,021 (GRCm39) missense probably damaging 1.00
IGL01982:Kntc1 APN 5 123,947,159 (GRCm39) missense probably benign 0.12
IGL02145:Kntc1 APN 5 123,900,661 (GRCm39) missense possibly damaging 0.80
IGL02510:Kntc1 APN 5 123,957,125 (GRCm39) missense probably benign 0.03
IGL02611:Kntc1 APN 5 123,950,128 (GRCm39) missense probably damaging 1.00
IGL02669:Kntc1 APN 5 123,893,727 (GRCm39) splice site probably benign
IGL02737:Kntc1 APN 5 123,957,183 (GRCm39) missense probably benign 0.17
IGL02793:Kntc1 APN 5 123,916,340 (GRCm39) splice site probably null
IGL02809:Kntc1 APN 5 123,914,645 (GRCm39) missense probably damaging 1.00
IGL02860:Kntc1 APN 5 123,907,936 (GRCm39) missense possibly damaging 0.49
IGL02875:Kntc1 APN 5 123,916,340 (GRCm39) splice site probably null
IGL02931:Kntc1 APN 5 123,937,874 (GRCm39) missense probably damaging 1.00
IGL03169:Kntc1 APN 5 123,913,884 (GRCm39) missense possibly damaging 0.80
IGL03267:Kntc1 APN 5 123,896,543 (GRCm39) missense probably damaging 1.00
R0006:Kntc1 UTSW 5 123,927,201 (GRCm39) missense probably benign 0.19
R0006:Kntc1 UTSW 5 123,927,201 (GRCm39) missense probably benign 0.19
R0017:Kntc1 UTSW 5 123,919,044 (GRCm39) missense probably damaging 1.00
R0125:Kntc1 UTSW 5 123,903,120 (GRCm39) splice site probably benign
R0324:Kntc1 UTSW 5 123,916,175 (GRCm39) missense probably damaging 1.00
R0580:Kntc1 UTSW 5 123,941,732 (GRCm39) missense probably benign 0.00
R0608:Kntc1 UTSW 5 123,924,137 (GRCm39) missense probably damaging 0.98
R0725:Kntc1 UTSW 5 123,907,767 (GRCm39) missense possibly damaging 0.92
R0733:Kntc1 UTSW 5 123,928,979 (GRCm39) missense probably null
R0781:Kntc1 UTSW 5 123,937,965 (GRCm39) splice site probably benign
R0787:Kntc1 UTSW 5 123,934,167 (GRCm39) missense probably benign
R1250:Kntc1 UTSW 5 123,922,262 (GRCm39) missense possibly damaging 0.71
R1253:Kntc1 UTSW 5 123,948,925 (GRCm39) frame shift probably null
R1467:Kntc1 UTSW 5 123,925,047 (GRCm39) missense probably benign 0.04
R1467:Kntc1 UTSW 5 123,925,047 (GRCm39) missense probably benign 0.04
R1481:Kntc1 UTSW 5 123,916,338 (GRCm39) missense probably benign 0.00
R1572:Kntc1 UTSW 5 123,910,176 (GRCm39) missense probably damaging 0.99
R1624:Kntc1 UTSW 5 123,896,540 (GRCm39) missense possibly damaging 0.48
R1749:Kntc1 UTSW 5 123,927,162 (GRCm39) missense probably benign 0.00
R1993:Kntc1 UTSW 5 123,948,874 (GRCm39) critical splice acceptor site probably null
R1993:Kntc1 UTSW 5 123,897,162 (GRCm39) critical splice donor site probably null
R2071:Kntc1 UTSW 5 123,932,340 (GRCm39) splice site probably null
R2237:Kntc1 UTSW 5 123,941,733 (GRCm39) missense possibly damaging 0.50
R2239:Kntc1 UTSW 5 123,941,733 (GRCm39) missense possibly damaging 0.50
R2366:Kntc1 UTSW 5 123,919,255 (GRCm39) missense probably damaging 1.00
R2382:Kntc1 UTSW 5 123,898,411 (GRCm39) missense probably damaging 0.99
R2389:Kntc1 UTSW 5 123,919,255 (GRCm39) missense probably damaging 1.00
R2413:Kntc1 UTSW 5 123,902,212 (GRCm39) missense probably benign 0.01
R2442:Kntc1 UTSW 5 123,948,922 (GRCm39) missense probably damaging 1.00
R2504:Kntc1 UTSW 5 123,916,410 (GRCm39) nonsense probably null
R2943:Kntc1 UTSW 5 123,935,847 (GRCm39) missense possibly damaging 0.68
R3116:Kntc1 UTSW 5 123,940,121 (GRCm39) missense probably damaging 1.00
R4107:Kntc1 UTSW 5 123,900,661 (GRCm39) missense probably damaging 0.99
R4176:Kntc1 UTSW 5 123,914,680 (GRCm39) missense possibly damaging 0.76
R4275:Kntc1 UTSW 5 123,905,842 (GRCm39) missense probably damaging 1.00
R4440:Kntc1 UTSW 5 123,932,216 (GRCm39) missense probably damaging 1.00
R4575:Kntc1 UTSW 5 123,904,018 (GRCm39) missense probably damaging 1.00
R4576:Kntc1 UTSW 5 123,904,018 (GRCm39) missense probably damaging 1.00
R4578:Kntc1 UTSW 5 123,904,018 (GRCm39) missense probably damaging 1.00
R4612:Kntc1 UTSW 5 123,950,706 (GRCm39) missense probably damaging 1.00
R4704:Kntc1 UTSW 5 123,949,496 (GRCm39) missense probably damaging 0.96
R4720:Kntc1 UTSW 5 123,903,086 (GRCm39) missense possibly damaging 0.65
R4784:Kntc1 UTSW 5 123,954,825 (GRCm39) missense possibly damaging 0.89
R4785:Kntc1 UTSW 5 123,954,825 (GRCm39) missense possibly damaging 0.89
R4824:Kntc1 UTSW 5 123,928,196 (GRCm39) nonsense probably null
R4847:Kntc1 UTSW 5 123,940,337 (GRCm39) missense probably benign 0.18
R4849:Kntc1 UTSW 5 123,897,128 (GRCm39) missense probably benign 0.02
R4904:Kntc1 UTSW 5 123,916,396 (GRCm39) missense possibly damaging 0.47
R4922:Kntc1 UTSW 5 123,940,309 (GRCm39) missense probably damaging 0.99
R5080:Kntc1 UTSW 5 123,900,649 (GRCm39) missense possibly damaging 0.68
R5114:Kntc1 UTSW 5 123,919,118 (GRCm39) critical splice donor site probably null
R5171:Kntc1 UTSW 5 123,937,907 (GRCm39) missense probably benign 0.01
R5220:Kntc1 UTSW 5 123,950,160 (GRCm39) missense probably damaging 1.00
R5226:Kntc1 UTSW 5 123,932,235 (GRCm39) missense probably benign 0.09
R5278:Kntc1 UTSW 5 123,919,077 (GRCm39) missense probably damaging 1.00
R5329:Kntc1 UTSW 5 123,902,254 (GRCm39) missense probably benign 0.02
R5496:Kntc1 UTSW 5 123,922,245 (GRCm39) missense probably benign 0.00
R5503:Kntc1 UTSW 5 123,957,939 (GRCm39) missense possibly damaging 0.81
R5633:Kntc1 UTSW 5 123,957,120 (GRCm39) missense probably damaging 0.99
R5638:Kntc1 UTSW 5 123,956,538 (GRCm39) missense possibly damaging 0.65
R5697:Kntc1 UTSW 5 123,903,070 (GRCm39) missense probably benign 0.00
R5757:Kntc1 UTSW 5 123,945,372 (GRCm39) critical splice donor site probably null
R5773:Kntc1 UTSW 5 123,932,220 (GRCm39) missense probably damaging 1.00
R5940:Kntc1 UTSW 5 123,924,258 (GRCm39) missense probably benign 0.05
R6019:Kntc1 UTSW 5 123,900,579 (GRCm39) missense probably benign 0.03
R6230:Kntc1 UTSW 5 123,927,072 (GRCm39) splice site probably null
R6437:Kntc1 UTSW 5 123,907,754 (GRCm39) missense probably damaging 0.98
R6888:Kntc1 UTSW 5 123,949,373 (GRCm39) missense probably damaging 1.00
R6907:Kntc1 UTSW 5 123,939,888 (GRCm39) missense probably damaging 1.00
R7123:Kntc1 UTSW 5 123,919,789 (GRCm39) missense probably damaging 1.00
R7262:Kntc1 UTSW 5 123,925,036 (GRCm39) missense probably benign 0.18
R7381:Kntc1 UTSW 5 123,948,971 (GRCm39) missense probably benign 0.12
R7485:Kntc1 UTSW 5 123,925,019 (GRCm39) missense possibly damaging 0.79
R7512:Kntc1 UTSW 5 123,929,001 (GRCm39) missense probably damaging 1.00
R7581:Kntc1 UTSW 5 123,954,818 (GRCm39) missense probably benign 0.05
R7687:Kntc1 UTSW 5 123,897,152 (GRCm39) missense probably benign 0.01
R7798:Kntc1 UTSW 5 123,957,180 (GRCm39) missense possibly damaging 0.94
R7798:Kntc1 UTSW 5 123,924,357 (GRCm39) missense probably benign
R7871:Kntc1 UTSW 5 123,922,290 (GRCm39) missense probably damaging 1.00
R7876:Kntc1 UTSW 5 123,913,850 (GRCm39) missense probably damaging 1.00
R7947:Kntc1 UTSW 5 123,919,951 (GRCm39) missense unknown
R7997:Kntc1 UTSW 5 123,916,117 (GRCm39) missense probably damaging 0.96
R8231:Kntc1 UTSW 5 123,920,959 (GRCm39) missense possibly damaging 0.47
R8257:Kntc1 UTSW 5 123,896,586 (GRCm39) critical splice donor site probably null
R8345:Kntc1 UTSW 5 123,924,993 (GRCm39) missense probably benign 0.37
R8354:Kntc1 UTSW 5 123,916,330 (GRCm39) missense probably damaging 1.00
R8732:Kntc1 UTSW 5 123,928,180 (GRCm39) missense probably benign 0.00
R8754:Kntc1 UTSW 5 123,897,115 (GRCm39) missense probably benign 0.01
R8947:Kntc1 UTSW 5 123,925,041 (GRCm39) missense probably benign 0.01
R9041:Kntc1 UTSW 5 123,927,093 (GRCm39) missense probably benign 0.00
R9182:Kntc1 UTSW 5 123,940,355 (GRCm39) missense probably damaging 1.00
R9432:Kntc1 UTSW 5 123,925,112 (GRCm39) missense possibly damaging 0.93
R9460:Kntc1 UTSW 5 123,941,378 (GRCm39) nonsense probably null
R9468:Kntc1 UTSW 5 123,954,776 (GRCm39) missense probably damaging 1.00
R9643:Kntc1 UTSW 5 123,949,440 (GRCm39) missense probably damaging 1.00
R9646:Kntc1 UTSW 5 123,897,119 (GRCm39) missense probably benign 0.01
R9721:Kntc1 UTSW 5 123,939,948 (GRCm39) missense probably benign 0.01
R9789:Kntc1 UTSW 5 123,898,706 (GRCm39) missense possibly damaging 0.87
X0027:Kntc1 UTSW 5 123,948,992 (GRCm39) missense probably benign 0.00
X0065:Kntc1 UTSW 5 123,916,100 (GRCm39) nonsense probably null
X0067:Kntc1 UTSW 5 123,916,137 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTTTGATGCTGTGCTGAAGATAATG -3'
(R):5'- TGACTCTCTCCCACATAATAAGTC -3'

Sequencing Primer
(F):5'- ATAATGTACAAGGCGGTGGTTCCC -3'
(R):5'- TCCCACATAATAAGTCTAGCTCTG -3'
Posted On 2014-10-30