Incidental Mutation 'R0284:Prpf40b'
ID 24637
Institutional Source Beutler Lab
Gene Symbol Prpf40b
Ensembl Gene ENSMUSG00000023007
Gene Name pre-mRNA processing factor 40B
Synonyms 2610317D23Rik
MMRRC Submission 038505-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock # R0284 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 99295087-99317018 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 99316393 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023745] [ENSMUST00000081224] [ENSMUST00000088233] [ENSMUST00000118287] [ENSMUST00000120633] [ENSMUST00000126955] [ENSMUST00000136980] [ENSMUST00000145482] [ENSMUST00000150636]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023745
SMART Domains Protein: ENSMUSP00000023745
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 693 776 N/A INTRINSIC
low complexity region 777 796 N/A INTRINSIC
low complexity region 809 825 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081224
SMART Domains Protein: ENSMUSP00000079984
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 227 2.99e-88 SMART
Drf_FH3 230 421 6.1e-71 SMART
low complexity region 448 497 N/A INTRINSIC
FH2 510 944 9.85e-141 SMART
low complexity region 960 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088233
SMART Domains Protein: ENSMUSP00000085566
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118287
SMART Domains Protein: ENSMUSP00000113282
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 694 777 N/A INTRINSIC
low complexity region 778 797 N/A INTRINSIC
low complexity region 810 826 N/A INTRINSIC
low complexity region 845 866 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120633
SMART Domains Protein: ENSMUSP00000113094
Gene: ENSMUSG00000023008

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
low complexity region 1011 1026 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124275
Predicted Effect probably benign
Transcript: ENSMUST00000126955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130575
Predicted Effect probably benign
Transcript: ENSMUST00000134034
SMART Domains Protein: ENSMUSP00000120030
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
Pfam:FF 11 62 2.2e-7 PFAM
low complexity region 77 92 N/A INTRINSIC
low complexity region 103 164 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 232 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136980
SMART Domains Protein: ENSMUSP00000122649
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
low complexity region 22 46 N/A INTRINSIC
low complexity region 50 81 N/A INTRINSIC
WW 87 119 7.6e-9 SMART
WW 128 160 1.75e-8 SMART
low complexity region 176 206 N/A INTRINSIC
low complexity region 249 261 N/A INTRINSIC
FF 270 324 2.36e-14 SMART
FF 404 464 6.94e-3 SMART
FF 484 544 1.41e0 SMART
FF 613 669 3.41e-11 SMART
low complexity region 681 764 N/A INTRINSIC
low complexity region 765 784 N/A INTRINSIC
low complexity region 797 813 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139330
Predicted Effect probably benign
Transcript: ENSMUST00000145482
SMART Domains Protein: ENSMUSP00000115869
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
low complexity region 1 24 N/A INTRINSIC
low complexity region 28 52 N/A INTRINSIC
low complexity region 56 87 N/A INTRINSIC
WW 93 125 7.6e-9 SMART
WW 134 166 1.75e-8 SMART
low complexity region 182 212 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
FF 276 330 2.36e-14 SMART
FF 410 470 6.94e-3 SMART
FF 490 550 1.41e0 SMART
low complexity region 557 568 N/A INTRINSIC
FF 626 682 3.41e-11 SMART
low complexity region 693 708 N/A INTRINSIC
low complexity region 719 780 N/A INTRINSIC
low complexity region 781 800 N/A INTRINSIC
low complexity region 813 829 N/A INTRINSIC
low complexity region 848 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150636
SMART Domains Protein: ENSMUSP00000119295
Gene: ENSMUSG00000023007

DomainStartEndE-ValueType
Pfam:FF 1 52 1.2e-7 PFAM
low complexity region 67 82 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153692
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.4%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WW-domain containing protein similar to yeast splicing factor PRP40. This protein has been shown to interact with Huntingtin and methyl CpG binding protein 2 (MeCP2). Alternative splicing results in different transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T G 4: 41,507,538 E150A probably damaging Het
Akap2 T C 4: 57,855,207 F220L probably damaging Het
Alkbh6 A G 7: 30,313,988 T161A probably benign Het
Alox12e A G 11: 70,320,899 probably benign Het
Ap1g2 A G 14: 55,101,692 probably benign Het
Arid2 A T 15: 96,378,967 probably benign Het
Bmp2k A T 5: 97,068,455 H604L unknown Het
Cacna1a A T 8: 84,612,285 M1705L probably damaging Het
Cacna1d A T 14: 30,072,105 D1526E probably damaging Het
Ccdc171 A G 4: 83,549,738 R107G possibly damaging Het
Cklf T C 8: 104,261,575 probably benign Het
Crabp1 A G 9: 54,764,926 K9E probably benign Het
Cspg4 A G 9: 56,886,139 D386G probably damaging Het
Cyp3a41b G A 5: 145,578,204 probably benign Het
Dsg1a T A 18: 20,331,627 V393E probably damaging Het
Ednrb C T 14: 103,820,013 G371D probably damaging Het
Efcab5 T C 11: 77,103,527 probably benign Het
Exoc2 A T 13: 30,877,625 probably benign Het
Fbn2 G A 18: 58,050,290 probably benign Het
Foxo6 T C 4: 120,269,002 S199G probably benign Het
Fpr1 T A 17: 17,877,356 I124F probably damaging Het
Gk5 A T 9: 96,181,770 probably null Het
Gys1 A T 7: 45,436,719 probably benign Het
Igfbp1 T C 11: 7,198,103 S49P probably damaging Het
Incenp A T 19: 9,893,993 S91T unknown Het
Itpkc G A 7: 27,214,543 R498* probably null Het
Kat6a A G 8: 22,939,803 T1725A unknown Het
Kiz T A 2: 146,863,810 C97S probably benign Het
Kri1 A G 9: 21,276,552 probably benign Het
Lipn A G 19: 34,080,706 S276G possibly damaging Het
Llgl1 A G 11: 60,712,141 T881A probably damaging Het
Man1a2 T C 3: 100,684,786 H26R probably damaging Het
Map3k5 T A 10: 20,000,613 F173I probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 A G 12: 57,457,069 Q341R probably damaging Het
Mllt6 G T 11: 97,678,605 A928S probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nipsnap3a C T 4: 52,997,178 T150I probably benign Het
Nsl1 A G 1: 191,065,230 E97G probably damaging Het
Olfr1278 T C 2: 111,292,586 V106A probably benign Het
Olfr251 G A 9: 38,378,584 M234I probably benign Het
Olfr736 G A 14: 50,392,995 V80M probably damaging Het
Olfr830 A T 9: 18,875,552 Y72F probably benign Het
Pdcd6ip A G 9: 113,662,504 L552S probably damaging Het
Plekhf2 T C 4: 10,990,595 probably benign Het
Prdm1 T C 10: 44,456,626 E96G probably damaging Het
Prpf40a T A 2: 53,150,647 E608D probably damaging Het
Rag2 T C 2: 101,630,119 V258A probably damaging Het
S100a5 A G 3: 90,611,574 I68V probably benign Het
Serpinb8 G A 1: 107,602,918 probably null Het
Slc24a4 T C 12: 102,260,481 V492A probably damaging Het
Spag6l T A 16: 16,780,766 Q287L probably damaging Het
Synpo2 C T 3: 123,079,734 W211* probably null Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Trerf1 A G 17: 47,319,545 noncoding transcript Het
Ttn G C 2: 76,846,704 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps13d A T 4: 145,144,802 M1900K probably benign Het
Vps41 A T 13: 18,853,440 D691V probably damaging Het
Zfp518b T C 5: 38,671,740 Y974C probably damaging Het
Zscan29 A T 2: 121,166,733 probably benign Het
Other mutations in Prpf40b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Prpf40b APN 15 99316131 missense probably benign 0.04
IGL00821:Prpf40b APN 15 99316501 missense probably benign 0.04
IGL00949:Prpf40b APN 15 99306538 missense probably benign 0.00
IGL01621:Prpf40b APN 15 99310045 unclassified probably benign
IGL01816:Prpf40b APN 15 99315218 missense probably damaging 1.00
IGL01878:Prpf40b APN 15 99306532 missense possibly damaging 0.84
IGL01886:Prpf40b APN 15 99304447 missense unknown
IGL02025:Prpf40b APN 15 99314588 missense probably damaging 1.00
IGL02440:Prpf40b APN 15 99306866 missense probably damaging 0.98
R0101:Prpf40b UTSW 15 99306800 splice site probably benign
R0356:Prpf40b UTSW 15 99305199 splice site probably null
R0602:Prpf40b UTSW 15 99304471 missense unknown
R0632:Prpf40b UTSW 15 99316289 missense probably benign 0.04
R1220:Prpf40b UTSW 15 99316348 missense probably benign 0.10
R1660:Prpf40b UTSW 15 99305561 missense probably damaging 1.00
R2224:Prpf40b UTSW 15 99303291 start gained probably benign
R2245:Prpf40b UTSW 15 99305166 intron probably benign
R2342:Prpf40b UTSW 15 99306168 missense probably damaging 0.98
R4019:Prpf40b UTSW 15 99316476 missense probably benign 0.10
R4449:Prpf40b UTSW 15 99314663 missense probably damaging 1.00
R4622:Prpf40b UTSW 15 99316316 missense probably benign 0.01
R4869:Prpf40b UTSW 15 99309845 intron probably benign
R5960:Prpf40b UTSW 15 99314904 missense probably damaging 1.00
R6734:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6735:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6776:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R6783:Prpf40b UTSW 15 99314903 missense probably damaging 1.00
R7025:Prpf40b UTSW 15 99306400 nonsense probably null
R7544:Prpf40b UTSW 15 99306018 missense probably benign 0.01
R7733:Prpf40b UTSW 15 99308343 critical splice donor site probably null
R8133:Prpf40b UTSW 15 99304438 missense unknown
R8193:Prpf40b UTSW 15 99304068 missense unknown
R8248:Prpf40b UTSW 15 99316285 missense unknown
R8669:Prpf40b UTSW 15 99303347 start codon destroyed probably null
R8670:Prpf40b UTSW 15 99309740 missense probably damaging 0.96
R9191:Prpf40b UTSW 15 99304183 missense probably null
X0019:Prpf40b UTSW 15 99307703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGACCAGTCCTGACAGTGAGAC -3'
(R):5'- TCTGAGAACTAGGGGACCCTTGAAC -3'

Sequencing Primer
(F):5'- TGACAGTGAGACGGACCC -3'
(R):5'- GCAACCTTGAGAGGTGCTAAC -3'
Posted On 2013-04-16