Incidental Mutation 'R2367:Mrgprb5'
ID246373
Institutional Source Beutler Lab
Gene Symbol Mrgprb5
Ensembl Gene ENSMUSG00000070551
Gene NameMAS-related GPR, member B5
SynonymsMrgB5
MMRRC Submission 040348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R2367 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48167983-48169019 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 48168599 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 129 (W129*)
Ref Sequence ENSEMBL: ENSMUSP00000091953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094389]
Predicted Effect probably null
Transcript: ENSMUST00000094389
AA Change: W129*
SMART Domains Protein: ENSMUSP00000091953
Gene: ENSMUSG00000070551
AA Change: W129*

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 38 217 1.4e-8 PFAM
Pfam:7tm_1 47 210 1.7e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq T C 16: 23,155,319 V32A probably benign Het
Ceacam3 T C 7: 17,151,888 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cfap46 C A 7: 139,653,498 V296F probably damaging Het
Ctdspl2 T C 2: 121,987,018 V182A probably benign Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Daxx C T 17: 33,911,847 R279W probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Galnt13 A T 2: 55,112,944 M552L probably benign Het
Gstt2 C T 10: 75,832,690 G108S probably benign Het
Heatr1 T A 13: 12,433,724 L422Q probably damaging Het
Kntc1 C T 5: 123,781,192 L845F probably damaging Het
Krtap26-1 C A 16: 88,647,325 R136L probably benign Het
Ms4a3 G A 19: 11,629,744 P186S probably benign Het
Myo15 T A 11: 60,517,238 M3184K probably damaging Het
Olfr1044 T C 2: 86,171,637 Y60C probably damaging Het
Olig2 G A 16: 91,226,566 R56Q possibly damaging Het
Pgap3 C T 11: 98,391,159 probably null Het
Phgdh C G 3: 98,314,296 G440A probably benign Het
Scn1a T C 2: 66,327,679 Q450R probably damaging Het
Sema4d CGGGG CGGGGGGG 13: 51,703,140 probably benign Het
Sik1 C T 17: 31,846,297 V776I possibly damaging Het
Slc25a39 T A 11: 102,403,651 T316S possibly damaging Het
Slc38a10 C T 11: 120,110,261 E578K probably benign Het
Slc44a5 T A 3: 154,247,809 I276K possibly damaging Het
Smarcc2 A G 10: 128,482,167 T610A possibly damaging Het
Spag9 G A 11: 94,116,757 S1090N probably damaging Het
Tpr T C 1: 150,433,728 V277A probably damaging Het
Traf3ip1 T G 1: 91,507,520 S314A possibly damaging Het
Tril T A 6: 53,819,166 D357V probably damaging Het
Tube1 T C 10: 39,144,919 L267P probably damaging Het
Vmn1r11 A G 6: 57,137,431 I27V probably benign Het
Other mutations in Mrgprb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mrgprb5 APN 7 48168384 missense probably damaging 1.00
IGL01662:Mrgprb5 APN 7 48168424 missense probably benign 0.02
IGL01752:Mrgprb5 APN 7 48168667 missense probably benign 0.22
IGL02117:Mrgprb5 APN 7 48168994 utr 5 prime probably benign
IGL02866:Mrgprb5 APN 7 48168166 missense probably damaging 0.99
IGL03382:Mrgprb5 APN 7 48168694 missense probably benign 0.01
R0545:Mrgprb5 UTSW 7 48168885 missense probably benign 0.08
R1389:Mrgprb5 UTSW 7 48168330 missense probably damaging 1.00
R1939:Mrgprb5 UTSW 7 48168938 missense probably benign 0.00
R2277:Mrgprb5 UTSW 7 48168831 missense probably damaging 1.00
R2912:Mrgprb5 UTSW 7 48168067 missense probably benign
R2968:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R2969:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R2970:Mrgprb5 UTSW 7 48168569 missense probably damaging 0.98
R3499:Mrgprb5 UTSW 7 48168913 missense probably benign 0.04
R3828:Mrgprb5 UTSW 7 48168091 missense probably benign 0.01
R4590:Mrgprb5 UTSW 7 48168061 missense probably benign 0.16
R4719:Mrgprb5 UTSW 7 48168778 missense probably damaging 1.00
R5263:Mrgprb5 UTSW 7 48168189 missense probably damaging 0.99
R5264:Mrgprb5 UTSW 7 48168048 missense probably benign 0.10
R5644:Mrgprb5 UTSW 7 48168207 missense probably benign 0.00
R6485:Mrgprb5 UTSW 7 48168777 missense probably damaging 0.99
R6713:Mrgprb5 UTSW 7 48168789 missense probably damaging 0.98
R7112:Mrgprb5 UTSW 7 48168907 missense probably benign
R7176:Mrgprb5 UTSW 7 48168311 missense possibly damaging 0.68
R7446:Mrgprb5 UTSW 7 48168504 missense possibly damaging 0.65
R7640:Mrgprb5 UTSW 7 48168259 missense probably benign 0.00
R7831:Mrgprb5 UTSW 7 48168249 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCATCTTGACCAACAGGGC -3'
(R):5'- GCTTGTGCTGATTTCTTGCAAC -3'

Sequencing Primer
(F):5'- TTGACCAACAGGGCCAGGC -3'
(R):5'- AACTTTGCACTCAGATTTTAGGTTCC -3'
Posted On2014-10-30