Incidental Mutation 'R2367:Gstt2'
ID246378
Institutional Source Beutler Lab
Gene Symbol Gstt2
Ensembl Gene ENSMUSG00000033318
Gene Nameglutathione S-transferase, theta 2
SynonymsYrs, mGSTT2
MMRRC Submission 040348-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2367 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75831114-75837424 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75832690 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 108 (G108S)
Ref Sequence ENSEMBL: ENSMUSP00000151307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038257] [ENSMUST00000218500] [ENSMUST00000220195] [ENSMUST00000220440]
Predicted Effect probably benign
Transcript: ENSMUST00000038257
AA Change: G108S

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046324
Gene: ENSMUSG00000033318
AA Change: G108S

DomainStartEndE-ValueType
Pfam:GST_N 1 76 4.6e-12 PFAM
Pfam:GST_N_3 5 84 1.4e-11 PFAM
Pfam:GST_N_2 11 77 3.5e-10 PFAM
Pfam:GST_C 73 199 1.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218034
Predicted Effect probably benign
Transcript: ENSMUST00000218500
AA Change: G108S

PolyPhen 2 Score 0.435 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219343
Predicted Effect probably benign
Transcript: ENSMUST00000220195
AA Change: G115S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000220440
AA Change: G108S

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a disruption in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq T C 16: 23,155,319 V32A probably benign Het
Ceacam3 T C 7: 17,151,888 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cfap46 C A 7: 139,653,498 V296F probably damaging Het
Ctdspl2 T C 2: 121,987,018 V182A probably benign Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Daxx C T 17: 33,911,847 R279W probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Galnt13 A T 2: 55,112,944 M552L probably benign Het
Heatr1 T A 13: 12,433,724 L422Q probably damaging Het
Kntc1 C T 5: 123,781,192 L845F probably damaging Het
Krtap26-1 C A 16: 88,647,325 R136L probably benign Het
Mrgprb5 C T 7: 48,168,599 W129* probably null Het
Ms4a3 G A 19: 11,629,744 P186S probably benign Het
Myo15 T A 11: 60,517,238 M3184K probably damaging Het
Olfr1044 T C 2: 86,171,637 Y60C probably damaging Het
Olig2 G A 16: 91,226,566 R56Q possibly damaging Het
Pgap3 C T 11: 98,391,159 probably null Het
Phgdh C G 3: 98,314,296 G440A probably benign Het
Scn1a T C 2: 66,327,679 Q450R probably damaging Het
Sema4d CGGGG CGGGGGGG 13: 51,703,140 probably benign Het
Sik1 C T 17: 31,846,297 V776I possibly damaging Het
Slc25a39 T A 11: 102,403,651 T316S possibly damaging Het
Slc38a10 C T 11: 120,110,261 E578K probably benign Het
Slc44a5 T A 3: 154,247,809 I276K possibly damaging Het
Smarcc2 A G 10: 128,482,167 T610A possibly damaging Het
Spag9 G A 11: 94,116,757 S1090N probably damaging Het
Tpr T C 1: 150,433,728 V277A probably damaging Het
Traf3ip1 T G 1: 91,507,520 S314A possibly damaging Het
Tril T A 6: 53,819,166 D357V probably damaging Het
Tube1 T C 10: 39,144,919 L267P probably damaging Het
Vmn1r11 A G 6: 57,137,431 I27V probably benign Het
Other mutations in Gstt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Gstt2 APN 10 75834171 splice site probably benign
IGL01710:Gstt2 APN 10 75833745 splice site probably benign
IGL02642:Gstt2 APN 10 75832818 missense probably benign 0.17
IGL03375:Gstt2 APN 10 75832821 splice site probably null
R0389:Gstt2 UTSW 10 75832432 missense probably damaging 1.00
R1751:Gstt2 UTSW 10 75834264 missense probably damaging 1.00
R1767:Gstt2 UTSW 10 75834264 missense probably damaging 1.00
R1971:Gstt2 UTSW 10 75832665 missense probably benign 0.10
R5027:Gstt2 UTSW 10 75831892 missense probably damaging 0.99
R7457:Gstt2 UTSW 10 75832520 missense probably damaging 1.00
R7579:Gstt2 UTSW 10 75834185 missense probably benign 0.00
R7910:Gstt2 UTSW 10 75831902 missense probably benign 0.25
R7912:Gstt2 UTSW 10 75832584 missense probably benign 0.27
R7991:Gstt2 UTSW 10 75831902 missense probably benign 0.25
R7993:Gstt2 UTSW 10 75832584 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGAACTTGTCCTCCAGCTGTTG -3'
(R):5'- GCCAAGGTCCTTAAATCCCC -3'

Sequencing Primer
(F):5'- TGTTGCAGAACCAGGACCATTCTATC -3'
(R):5'- CTCTTCCCATGGTCCATATAGC -3'
Posted On2014-10-30