Mutagenetix > Incidental Mutation

Incidental Mutation 'R2367:Heatr1'

246385

Institutional Source

Beutler Lab

Gene Symbol

Heatr1

Ensembl Gene

ENSMUSG00000050244

Gene Name

HEAT repeat containing 1

Synonyms

B130016L12Rik

MMRRC Submission

040348-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R2367 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12395027-12440289 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 12433724 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 422 (L422Q)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059270]

AlphaFold

G3X9B1

Predicted Effect

probably damaging
Transcript: ENSMUST00000059270
AA Change: L1822Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: L1822Q

Domain	Start	End	E-Value	Type
low complexity region	4	15	N/A	INTRINSIC
Pfam:U3snoRNP10	238	354	7e-30	PFAM
SCOP:d1qbkb_	919	1795	3e-8	SMART
low complexity region	1805	1814	N/A	INTRINSIC
BP28CT	1856	2009	2.25e-77	SMART
Blast:BP28CT	2015	2061	2e-15	BLAST
coiled coil region	2109	2137	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221051

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221616

Predicted Effect

probably damaging
Transcript: ENSMUST00000222091
AA Change: L422Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adipoq	T	C	16: 23,155,319	V32A	probably benign	Het
Ceacam3	T	C	7: 17,151,888		probably null	Het
Cep250	G	A	2: 155,992,632	R2159K	probably damaging	Het
Cfap46	C	A	7: 139,653,498	V296F	probably damaging	Het
Ctdspl2	T	C	2: 121,987,018	V182A	probably benign	Het
Cyp2c69	T	C	19: 39,877,594	N185S	probably benign	Het
Daxx	C	T	17: 33,911,847	R279W	probably benign	Het
Dnajc28	G	A	16: 91,616,867	T187M	probably damaging	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Galnt13	A	T	2: 55,112,944	M552L	probably benign	Het
Gstt2	C	T	10: 75,832,690	G108S	probably benign	Het
Kntc1	C	T	5: 123,781,192	L845F	probably damaging	Het
Krtap26-1	C	A	16: 88,647,325	R136L	probably benign	Het
Mrgprb5	C	T	7: 48,168,599	W129*	probably null	Het
Ms4a3	G	A	19: 11,629,744	P186S	probably benign	Het
Myo15	T	A	11: 60,517,238	M3184K	probably damaging	Het
Olfr1044	T	C	2: 86,171,637	Y60C	probably damaging	Het
Olig2	G	A	16: 91,226,566	R56Q	possibly damaging	Het
Pgap3	C	T	11: 98,391,159		probably null	Het
Phgdh	C	G	3: 98,314,296	G440A	probably benign	Het
Scn1a	T	C	2: 66,327,679	Q450R	probably damaging	Het
Sema4d	CGGGG	CGGGGGGG	13: 51,703,140		probably benign	Het
Sik1	C	T	17: 31,846,297	V776I	possibly damaging	Het
Slc25a39	T	A	11: 102,403,651	T316S	possibly damaging	Het
Slc38a10	C	T	11: 120,110,261	E578K	probably benign	Het
Slc44a5	T	A	3: 154,247,809	I276K	possibly damaging	Het
Smarcc2	A	G	10: 128,482,167	T610A	possibly damaging	Het
Spag9	G	A	11: 94,116,757	S1090N	probably damaging	Het
Tpr	T	C	1: 150,433,728	V277A	probably damaging	Het
Traf3ip1	T	G	1: 91,507,520	S314A	possibly damaging	Het
Tril	T	A	6: 53,819,166	D357V	probably damaging	Het
Tube1	T	C	10: 39,144,919	L267P	probably damaging	Het
Vmn1r11	A	G	6: 57,137,431	I27V	probably benign	Het

Other mutations in Heatr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00666:Heatr1	APN	13	12410450	missense	probably benign	0.00
IGL00863:Heatr1	APN	13	12435128	missense	probably benign	0.02
IGL00899:Heatr1	APN	13	12435176	missense	probably benign	0.31
IGL01147:Heatr1	APN	13	12437912	missense	probably damaging	0.99
IGL01317:Heatr1	APN	13	12399027	missense	probably damaging	1.00
IGL01323:Heatr1	APN	13	12398938	missense	possibly damaging	0.86
IGL01625:Heatr1	APN	13	12413528	missense	probably damaging	0.98
IGL01973:Heatr1	APN	13	12429799	missense	probably benign
IGL02803:Heatr1	APN	13	12433986	missense	probably damaging	0.96
IGL02830:Heatr1	APN	13	12426212	missense	possibly damaging	0.57
IGL02956:Heatr1	APN	13	12416059	missense	possibly damaging	0.53
IGL03000:Heatr1	APN	13	12434411	missense	probably damaging	0.99
IGL03024:Heatr1	APN	13	12407509	unclassified	probably benign
IGL03035:Heatr1	APN	13	12413219	splice site	probably benign
IGL03301:Heatr1	APN	13	12434205	missense	probably damaging	1.00
hasan	UTSW	13	12417447	splice site	probably benign
H8562:Heatr1	UTSW	13	12408713	missense	probably benign	0.13
R0226:Heatr1	UTSW	13	12410562	missense	probably damaging	1.00
R0571:Heatr1	UTSW	13	12430240	missense	probably damaging	0.98
R0722:Heatr1	UTSW	13	12406037	missense	probably benign	0.14
R1264:Heatr1	UTSW	13	12424610	unclassified	probably benign
R1371:Heatr1	UTSW	13	12417632	missense	possibly damaging	0.80
R1388:Heatr1	UTSW	13	12417447	splice site	probably benign
R1396:Heatr1	UTSW	13	12406046	missense	possibly damaging	0.86
R1519:Heatr1	UTSW	13	12412159	missense	probably benign
R1689:Heatr1	UTSW	13	12424625	missense	probably benign	0.00
R1696:Heatr1	UTSW	13	12423721	missense	possibly damaging	0.96
R1756:Heatr1	UTSW	13	12396460	missense	probably benign	0.01
R1859:Heatr1	UTSW	13	12403159	missense	probably damaging	1.00
R1932:Heatr1	UTSW	13	12435185	missense	probably damaging	1.00
R1957:Heatr1	UTSW	13	12396538	missense	probably damaging	1.00
R2018:Heatr1	UTSW	13	12414478	missense	possibly damaging	0.68
R2106:Heatr1	UTSW	13	12412058	missense	probably benign	0.03
R2119:Heatr1	UTSW	13	12432646	missense	probably null	1.00
R2121:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R2122:Heatr1	UTSW	13	12403264	missense	probably benign	0.10
R3777:Heatr1	UTSW	13	12413348	missense	possibly damaging	0.92
R3783:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3784:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3786:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3787:Heatr1	UTSW	13	12434460	missense	probably damaging	1.00
R3843:Heatr1	UTSW	13	12435121	missense	probably benign	0.00
R4533:Heatr1	UTSW	13	12434511	missense	probably benign	0.05
R4725:Heatr1	UTSW	13	12424662	nonsense	probably null
R4763:Heatr1	UTSW	13	12430930	missense	possibly damaging	0.65
R4793:Heatr1	UTSW	13	12431837	missense	probably benign	0.00
R4797:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4798:Heatr1	UTSW	13	12412048	missense	probably benign	0.36
R4942:Heatr1	UTSW	13	12413510	critical splice acceptor site	probably null
R4952:Heatr1	UTSW	13	12410599	missense	probably benign	0.38
R4954:Heatr1	UTSW	13	12407516	critical splice acceptor site	probably null
R5370:Heatr1	UTSW	13	12401522	missense	probably benign	0.02
R5464:Heatr1	UTSW	13	12433643	missense	probably benign	0.00
R5483:Heatr1	UTSW	13	12398914	missense	probably damaging	1.00
R5497:Heatr1	UTSW	13	12421064	missense	possibly damaging	0.93
R5504:Heatr1	UTSW	13	12406619	missense	possibly damaging	0.64
R5527:Heatr1	UTSW	13	12402760	missense	probably damaging	1.00
R5527:Heatr1	UTSW	13	12404948	missense	probably benign
R5836:Heatr1	UTSW	13	12408736	missense	probably damaging	0.99
R5916:Heatr1	UTSW	13	12434471	missense	probably damaging	1.00
R6018:Heatr1	UTSW	13	12404947	missense	probably benign
R6018:Heatr1	UTSW	13	12406058	missense	probably benign	0.26
R6216:Heatr1	UTSW	13	12432664	missense	probably benign	0.16
R6396:Heatr1	UTSW	13	12406097	missense	possibly damaging	0.86
R6472:Heatr1	UTSW	13	12434230	missense	probably benign	0.29
R6922:Heatr1	UTSW	13	12435075	missense	probably benign	0.00
R7077:Heatr1	UTSW	13	12418164	missense	possibly damaging	0.63
R7297:Heatr1	UTSW	13	12421060	nonsense	probably null
R7445:Heatr1	UTSW	13	12431038	missense	possibly damaging	0.70
R7669:Heatr1	UTSW	13	12411262	missense	probably benign	0.33
R7672:Heatr1	UTSW	13	12438664	missense	probably damaging	0.96
R7772:Heatr1	UTSW	13	12417641	missense	probably benign	0.03
R8205:Heatr1	UTSW	13	12416047	missense	probably benign
R8518:Heatr1	UTSW	13	12410534	missense	probably benign
R8754:Heatr1	UTSW	13	12413294	missense	probably damaging	0.99
R8874:Heatr1	UTSW	13	12430912	missense	probably damaging	1.00
R8992:Heatr1	UTSW	13	12401114	missense	probably damaging	0.98
R9045:Heatr1	UTSW	13	12413352	missense	probably benign	0.00
R9077:Heatr1	UTSW	13	12413366	missense	probably benign
R9183:Heatr1	UTSW	13	12421385	missense	probably damaging	0.99
R9186:Heatr1	UTSW	13	12421346	missense	probably damaging	1.00
R9223:Heatr1	UTSW	13	12404921	missense	probably benign	0.00
R9242:Heatr1	UTSW	13	12433925	missense	probably benign
R9267:Heatr1	UTSW	13	12406608	missense	probably damaging	1.00
R9289:Heatr1	UTSW	13	12432727	missense	probably benign	0.13
R9310:Heatr1	UTSW	13	12438610	missense	probably benign
R9312:Heatr1	UTSW	13	12431684	missense	probably benign
R9358:Heatr1	UTSW	13	12418206	missense	probably benign	0.09
R9385:Heatr1	UTSW	13	12406542	missense	probably damaging	1.00
R9530:Heatr1	UTSW	13	12424726	missense	probably damaging	1.00
R9532:Heatr1	UTSW	13	12414425	missense	possibly damaging	0.72
R9647:Heatr1	UTSW	13	12426798	missense	probably benign	0.00
R9683:Heatr1	UTSW	13	12434259	missense	probably damaging	1.00
R9695:Heatr1	UTSW	13	12423743	missense	probably damaging	1.00
RF011:Heatr1	UTSW	13	12407544	missense	probably benign	0.00
Z1176:Heatr1	UTSW	13	12399008	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- ATCCTGTGAGTGTGCTTGCC -3'
(R):5'- CAATGTGCTCTTGTAAGATGCTC -3'

Sequencing Primer
(F):5'- TTGCCAGCACAGTCCAGTG -3'
(R):5'- TAAATGGGCCCATGTGATTCTACCG -3'

Posted On

2014-10-30