Incidental Mutation 'R2368:Olfr1098'
ID246395
Institutional Source Beutler Lab
Gene Symbol Olfr1098
Ensembl Gene ENSMUSG00000075169
Gene Nameolfactory receptor 1098
SynonymsMOR206-1, GA_x6K02T2Q125-48410458-48409511
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R2368 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86920949-86924545 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86923107 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 142 (Y142N)
Ref Sequence ENSEMBL: ENSMUSP00000107200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099872] [ENSMUST00000111574]
Predicted Effect probably benign
Transcript: ENSMUST00000099872
AA Change: Y142N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097457
Gene: ENSMUSG00000075169
AA Change: Y142N

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 7e-29 PFAM
Pfam:7tm_4 140 283 3.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111574
AA Change: Y142N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107200
Gene: ENSMUSG00000075169
AA Change: Y142N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-52 PFAM
Pfam:7tm_1 41 309 8.1e-20 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,350,012 K102E possibly damaging Het
Bsn G A 9: 108,111,030 Q2508* probably null Het
Cc2d2a A G 5: 43,703,888 T549A probably benign Het
Lyst A T 13: 13,696,663 S2662C probably damaging Het
Nek9 A G 12: 85,329,887 V240A possibly damaging Het
Nol4l T C 2: 153,418,039 D165G probably damaging Het
Olfr126 A T 17: 37,850,618 M9L probably benign Het
Olfr1335 A G 4: 118,809,822 V14A probably benign Het
Olfr494 A G 7: 108,368,369 Y293C probably damaging Het
Plin5 T C 17: 56,115,588 E116G probably damaging Het
Slc35d2 C T 13: 64,129,305 M1I probably null Het
Srgap1 A T 10: 121,829,289 S493T probably benign Het
Syt9 T A 7: 107,436,699 Y308N probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r74 C T 7: 85,961,314 D57N probably benign Het
Vstm5 A T 9: 15,257,731 M166L probably benign Het
Zbtb12 T C 17: 34,895,698 L153P possibly damaging Het
Other mutations in Olfr1098
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Olfr1098 APN 2 86922949 missense probably benign
IGL02547:Olfr1098 APN 2 86923028 missense probably damaging 1.00
IGL02881:Olfr1098 APN 2 86922713 missense possibly damaging 0.94
IGL03073:Olfr1098 APN 2 86923353 missense probably damaging 1.00
R0117:Olfr1098 UTSW 2 86922870 missense probably damaging 1.00
R0808:Olfr1098 UTSW 2 86923451 missense probably damaging 1.00
R1061:Olfr1098 UTSW 2 86922782 missense possibly damaging 0.93
R1471:Olfr1098 UTSW 2 86922578 unclassified probably null
R1571:Olfr1098 UTSW 2 86923445 missense probably benign 0.01
R1680:Olfr1098 UTSW 2 86923161 missense probably benign 0.10
R2341:Olfr1098 UTSW 2 86922638 missense possibly damaging 0.63
R3158:Olfr1098 UTSW 2 86922606 missense probably benign
R3425:Olfr1098 UTSW 2 86922606 missense probably benign
R3499:Olfr1098 UTSW 2 86923029 missense possibly damaging 0.94
R4156:Olfr1098 UTSW 2 86922878 missense probably damaging 1.00
R4526:Olfr1098 UTSW 2 86922995 missense possibly damaging 0.90
R5743:Olfr1098 UTSW 2 86923205 missense probably benign 0.01
R5942:Olfr1098 UTSW 2 86923406 missense probably damaging 1.00
R6372:Olfr1098 UTSW 2 86923155 missense probably damaging 1.00
R6409:Olfr1098 UTSW 2 86923171 nonsense probably null
R6517:Olfr1098 UTSW 2 86923097 missense probably benign 0.05
R6661:Olfr1098 UTSW 2 86923148 missense probably benign 0.02
R7075:Olfr1098 UTSW 2 86922646 missense possibly damaging 0.88
R7166:Olfr1098 UTSW 2 86922748 missense probably damaging 0.97
R8058:Olfr1098 UTSW 2 86922807 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CGGATATCGTGATTAGCGACAGC -3'
(R):5'- TTACAGAATACGCTGACCTCC -3'

Sequencing Primer
(F):5'- CCAGCTAAAACGAATATTGTGGC -3'
(R):5'- TCGTCAATGGCCTATGAC -3'
Posted On2014-10-30