Incidental Mutation 'R2368:Nol4l'
ID246396
Institutional Source Beutler Lab
Gene Symbol Nol4l
Ensembl Gene ENSMUSG00000061411
Gene Namenucleolar protein 4-like
SynonymsLOC381396, 8430427H17Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R2368 (G1)
Quality Score199
Status Not validated
Chromosome2
Chromosomal Location153407462-153529971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 153418039 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 165 (D165G)
Ref Sequence ENSEMBL: ENSMUSP00000105407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035346] [ENSMUST00000035346] [ENSMUST00000109784] [ENSMUST00000109784]
Predicted Effect probably damaging
Transcript: ENSMUST00000035346
AA Change: D409G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036571
Gene: ENSMUSG00000061411
AA Change: D409G

DomainStartEndE-ValueType
low complexity region 58 71 N/A INTRINSIC
low complexity region 277 305 N/A INTRINSIC
low complexity region 405 422 N/A INTRINSIC
low complexity region 619 639 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000035346
AA Change: D409G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036571
Gene: ENSMUSG00000061411
AA Change: D409G

DomainStartEndE-ValueType
low complexity region 58 71 N/A INTRINSIC
low complexity region 277 305 N/A INTRINSIC
low complexity region 405 422 N/A INTRINSIC
low complexity region 619 639 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109784
AA Change: D165G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105407
Gene: ENSMUSG00000061411
AA Change: D165G

DomainStartEndE-ValueType
low complexity region 33 61 N/A INTRINSIC
SCOP:d1sig__ 161 246 1e-2 SMART
low complexity region 375 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109784
AA Change: D165G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105407
Gene: ENSMUSG00000061411
AA Change: D165G

DomainStartEndE-ValueType
low complexity region 33 61 N/A INTRINSIC
SCOP:d1sig__ 161 246 1e-2 SMART
low complexity region 375 395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132770
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,350,012 K102E possibly damaging Het
Bsn G A 9: 108,111,030 Q2508* probably null Het
Cc2d2a A G 5: 43,703,888 T549A probably benign Het
Lyst A T 13: 13,696,663 S2662C probably damaging Het
Nek9 A G 12: 85,329,887 V240A possibly damaging Het
Olfr1098 A T 2: 86,923,107 Y142N probably benign Het
Olfr126 A T 17: 37,850,618 M9L probably benign Het
Olfr1335 A G 4: 118,809,822 V14A probably benign Het
Olfr494 A G 7: 108,368,369 Y293C probably damaging Het
Plin5 T C 17: 56,115,588 E116G probably damaging Het
Slc35d2 C T 13: 64,129,305 M1I probably null Het
Srgap1 A T 10: 121,829,289 S493T probably benign Het
Syt9 T A 7: 107,436,699 Y308N probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r74 C T 7: 85,961,314 D57N probably benign Het
Vstm5 A T 9: 15,257,731 M166L probably benign Het
Zbtb12 T C 17: 34,895,698 L153P possibly damaging Het
Other mutations in Nol4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Nol4l APN 2 153477936 missense probably damaging 0.96
IGL01325:Nol4l APN 2 153436351 splice site probably benign
IGL02608:Nol4l APN 2 153436293 missense possibly damaging 0.50
IGL02886:Nol4l APN 2 153529537 missense probably benign 0.27
IGL03210:Nol4l APN 2 153529458 missense probably benign 0.03
IGL03055:Nol4l UTSW 2 153436270 synonymous silent
R0285:Nol4l UTSW 2 153483853 splice site probably benign
R0345:Nol4l UTSW 2 153411752 missense probably benign 0.00
R0555:Nol4l UTSW 2 153417684 splice site probably null
R1966:Nol4l UTSW 2 153529455 missense probably benign 0.01
R2044:Nol4l UTSW 2 153529521 missense possibly damaging 0.66
R4855:Nol4l UTSW 2 153411806 missense probably benign 0.06
R5696:Nol4l UTSW 2 153418106 missense probably damaging 0.99
R5776:Nol4l UTSW 2 153417821 missense probably damaging 1.00
R6807:Nol4l UTSW 2 153483826 nonsense probably null
R6845:Nol4l UTSW 2 153416662 missense probably benign 0.00
R6872:Nol4l UTSW 2 153483817 missense probably damaging 0.98
R6940:Nol4l UTSW 2 153411764 missense probably benign 0.00
R8165:Nol4l UTSW 2 153420553 nonsense probably null
R8263:Nol4l UTSW 2 153417417 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAGGTTCTCATCCACGAAGAG -3'
(R):5'- CACAGTGGGAAGTAGGGTTC -3'

Sequencing Primer
(F):5'- AGAGCCGCACGAACATCTGG -3'
(R):5'- AAGTAGGGTTCACTTGCTGACC -3'
Posted On2014-10-30