Incidental Mutation 'R2368:Olfr1335'
ID246397
Institutional Source Beutler Lab
Gene Symbol Olfr1335
Ensembl Gene ENSMUSG00000066061
Gene Nameolfactory receptor 1335
SynonymsGA_x6K02T2QD9B-18723799-18724749, GA_x6K02T2QD9B-18726774-18727577, MOR259-12, MOR259-5, Olfr1334-ps1, Olfr1335
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R2368 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118808797-118809944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118809822 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 14 (V14A)
Ref Sequence ENSEMBL: ENSMUSP00000151219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084313] [ENSMUST00000219094]
Predicted Effect probably benign
Transcript: ENSMUST00000084313
SMART Domains Protein: ENSMUSP00000081339
Gene: ENSMUSG00000066061

DomainStartEndE-ValueType
Pfam:7tm_4 50 326 2.3e-56 PFAM
Pfam:7TM_GPCR_Srsx 54 323 3.7e-8 PFAM
Pfam:7tm_1 60 309 2.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219094
AA Change: V14A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,350,012 K102E possibly damaging Het
Bsn G A 9: 108,111,030 Q2508* probably null Het
Cc2d2a A G 5: 43,703,888 T549A probably benign Het
Lyst A T 13: 13,696,663 S2662C probably damaging Het
Nek9 A G 12: 85,329,887 V240A possibly damaging Het
Nol4l T C 2: 153,418,039 D165G probably damaging Het
Olfr1098 A T 2: 86,923,107 Y142N probably benign Het
Olfr126 A T 17: 37,850,618 M9L probably benign Het
Olfr494 A G 7: 108,368,369 Y293C probably damaging Het
Plin5 T C 17: 56,115,588 E116G probably damaging Het
Slc35d2 C T 13: 64,129,305 M1I probably null Het
Srgap1 A T 10: 121,829,289 S493T probably benign Het
Syt9 T A 7: 107,436,699 Y308N probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r74 C T 7: 85,961,314 D57N probably benign Het
Vstm5 A T 9: 15,257,731 M166L probably benign Het
Zbtb12 T C 17: 34,895,698 L153P possibly damaging Het
Other mutations in Olfr1335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr1335 APN 4 118809456 missense probably damaging 0.98
IGL02481:Olfr1335 APN 4 118809499 missense probably benign 0.01
IGL02483:Olfr1335 APN 4 118809499 missense probably benign 0.01
R0058:Olfr1335 UTSW 4 118809480 missense probably benign
R0069:Olfr1335 UTSW 4 118809690 missense probably damaging 1.00
R0357:Olfr1335 UTSW 4 118809417 missense probably damaging 1.00
R1274:Olfr1335 UTSW 4 118809396 missense probably benign 0.01
R1432:Olfr1335 UTSW 4 118809238 missense probably benign 0.00
R2305:Olfr1335 UTSW 4 118808861 missense probably benign 0.35
R3842:Olfr1335 UTSW 4 118809255 missense probably damaging 1.00
R3980:Olfr1335 UTSW 4 118809303 missense probably benign 0.22
R4722:Olfr1335 UTSW 4 118808949 missense probably damaging 0.99
R5074:Olfr1335 UTSW 4 118808860 missense possibly damaging 0.82
R5439:Olfr1335 UTSW 4 118809363 missense possibly damaging 0.95
R5930:Olfr1335 UTSW 4 118809378 missense probably benign 0.01
R6917:Olfr1335 UTSW 4 118809129 missense probably damaging 1.00
R7287:Olfr1335 UTSW 4 118809742 missense probably benign 0.01
R7525:Olfr1335 UTSW 4 118809494 missense probably damaging 0.99
R7717:Olfr1335 UTSW 4 118808933 missense probably damaging 0.99
R8293:Olfr1335 UTSW 4 118809742 missense probably benign 0.01
R8765:Olfr1335 UTSW 4 118808962 missense probably benign 0.05
X0023:Olfr1335 UTSW 4 118809621 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATACCAGCATGATGATG -3'
(R):5'- GCTTAGAAGCCACATTGCAATC -3'

Sequencing Primer
(F):5'- CAGCATGATGATGAGCCCGTTG -3'
(R):5'- CACCAAGTGTGTGTCTGGAC -3'
Posted On2014-10-30