Incidental Mutation 'R2368:Olfr494'
ID246401
Institutional Source Beutler Lab
Gene Symbol Olfr494
Ensembl Gene ENSMUSG00000109631
Gene Nameolfactory receptor 494
SynonymsMOR204-10, GA_x6K02T2PBJ9-10697517-10698461
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R2368 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108365335-108368436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108368369 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 293 (Y293C)
Ref Sequence ENSEMBL: ENSMUSP00000147830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073059] [ENSMUST00000209743] [ENSMUST00000210291]
Predicted Effect probably damaging
Transcript: ENSMUST00000073059
AA Change: Y293C

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072810
Gene: ENSMUSG00000109542
AA Change: Y293C

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2e-56 PFAM
Pfam:7tm_1 44 293 2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209743
AA Change: Y293C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000210291
AA Change: Y293C

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.7465 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid2 A G 15: 96,350,012 K102E possibly damaging Het
Bsn G A 9: 108,111,030 Q2508* probably null Het
Cc2d2a A G 5: 43,703,888 T549A probably benign Het
Lyst A T 13: 13,696,663 S2662C probably damaging Het
Nek9 A G 12: 85,329,887 V240A possibly damaging Het
Nol4l T C 2: 153,418,039 D165G probably damaging Het
Olfr1098 A T 2: 86,923,107 Y142N probably benign Het
Olfr126 A T 17: 37,850,618 M9L probably benign Het
Olfr1335 A G 4: 118,809,822 V14A probably benign Het
Plin5 T C 17: 56,115,588 E116G probably damaging Het
Slc35d2 C T 13: 64,129,305 M1I probably null Het
Srgap1 A T 10: 121,829,289 S493T probably benign Het
Syt9 T A 7: 107,436,699 Y308N probably damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r74 C T 7: 85,961,314 D57N probably benign Het
Vstm5 A T 9: 15,257,731 M166L probably benign Het
Zbtb12 T C 17: 34,895,698 L153P possibly damaging Het
Other mutations in Olfr494
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Olfr494 APN 7 108368318 missense probably damaging 1.00
IGL01934:Olfr494 APN 7 108368161 missense probably damaging 0.99
IGL02041:Olfr494 APN 7 108367535 missense probably damaging 1.00
IGL02253:Olfr494 APN 7 108368054 missense possibly damaging 0.80
IGL02902:Olfr494 APN 7 108368129 missense probably damaging 1.00
R0125:Olfr494 UTSW 7 108368369 missense probably damaging 0.98
R0523:Olfr494 UTSW 7 108368231 missense probably damaging 1.00
R0650:Olfr494 UTSW 7 108367789 missense probably damaging 1.00
R1268:Olfr494 UTSW 7 108367795 missense probably benign 0.06
R2036:Olfr494 UTSW 7 108367740 missense probably benign 0.00
R2162:Olfr494 UTSW 7 108367562 missense probably benign 0.08
R2278:Olfr494 UTSW 7 108368081 missense probably benign 0.01
R3410:Olfr494 UTSW 7 108368344 missense possibly damaging 0.52
R3411:Olfr494 UTSW 7 108368344 missense possibly damaging 0.52
R3834:Olfr494 UTSW 7 108368072 missense probably damaging 0.98
R4322:Olfr494 UTSW 7 108368348 missense probably damaging 1.00
R4625:Olfr494 UTSW 7 108367688 missense probably damaging 0.98
R4724:Olfr494 UTSW 7 108367998 missense probably benign
R4843:Olfr494 UTSW 7 108368143 missense probably benign 0.01
R5525:Olfr494 UTSW 7 108367999 missense probably benign
R5954:Olfr494 UTSW 7 108367601 missense probably damaging 0.98
R7027:Olfr494 UTSW 7 108368350 missense probably damaging 0.98
R8041:Olfr494 UTSW 7 108367534 missense probably damaging 1.00
R8237:Olfr494 UTSW 7 108368027 missense probably damaging 1.00
Z1177:Olfr494 UTSW 7 108368261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGAAGATGCACTCCACTGAG -3'
(R):5'- TAGCCACATATACTGCAAGGAAAAG -3'

Sequencing Primer
(F):5'- AGGGCAGACACAAGGCCTTC -3'
(R):5'- ACATATACTGCAAGGAAAAGGATATG -3'
Posted On2014-10-30